Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638800_a_at:

>probe:Drosophila_2:1638800_a_at:515:271; Interrogation_Position=390; Antisense; CATCTGAGGAAGGAGCCATCCACTT
>probe:Drosophila_2:1638800_a_at:237:209; Interrogation_Position=488; Antisense; AAGCATTTGCCAGCTGGACTTTCGC
>probe:Drosophila_2:1638800_a_at:415:557; Interrogation_Position=503; Antisense; GGACTTTCGCTCCAAAACGATGGCC
>probe:Drosophila_2:1638800_a_at:529:129; Interrogation_Position=528; Antisense; ACCATGTGGATGGACAAGCTGCGCC
>probe:Drosophila_2:1638800_a_at:282:105; Interrogation_Position=569; Antisense; AGACGAGGCCAGATCTAGGAACATA
>probe:Drosophila_2:1638800_a_at:573:655; Interrogation_Position=592; Antisense; TAATAACATCCCATCTGCTCAAGTG
>probe:Drosophila_2:1638800_a_at:50:41; Interrogation_Position=604; Antisense; ATCTGCTCAAGTGCTGTGGCGATAA
>probe:Drosophila_2:1638800_a_at:426:657; Interrogation_Position=638; Antisense; TAAGGAGCCATTCAATCATCCTCCG
>probe:Drosophila_2:1638800_a_at:286:427; Interrogation_Position=690; Antisense; GAGATGATGTTCTTAACGCGCGATA
>probe:Drosophila_2:1638800_a_at:340:133; Interrogation_Position=705; Antisense; ACGCGCGATAGTACGTGCCACGGAA
>probe:Drosophila_2:1638800_a_at:97:565; Interrogation_Position=726; Antisense; GGAATGCCCATTTCCAAGCAGATGG
>probe:Drosophila_2:1638800_a_at:543:99; Interrogation_Position=745; Antisense; AGATGGAACCCAACGCCAATCTAAC
>probe:Drosophila_2:1638800_a_at:264:647; Interrogation_Position=786; Antisense; TCATACGATGGTGGCGAGTTCCTGA
>probe:Drosophila_2:1638800_a_at:202:471; Interrogation_Position=803; Antisense; GTTCCTGAGAAAGCTTCCAGTGCCA

Paste this into a BLAST search page for me
CATCTGAGGAAGGAGCCATCCACTTAAGCATTTGCCAGCTGGACTTTCGCGGACTTTCGCTCCAAAACGATGGCCACCATGTGGATGGACAAGCTGCGCCAGACGAGGCCAGATCTAGGAACATATAATAACATCCCATCTGCTCAAGTGATCTGCTCAAGTGCTGTGGCGATAATAAGGAGCCATTCAATCATCCTCCGGAGATGATGTTCTTAACGCGCGATAACGCGCGATAGTACGTGCCACGGAAGGAATGCCCATTTCCAAGCAGATGGAGATGGAACCCAACGCCAATCTAACTCATACGATGGTGGCGAGTTCCTGAGTTCCTGAGAAAGCTTCCAGTGCCA

Full Affymetrix probeset data:

Annotations for 1638800_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime