Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638801_at:

>probe:Drosophila_2:1638801_at:208:517; Interrogation_Position=302; Antisense; GTGTGGCGGCCGGATACGAATACAA
>probe:Drosophila_2:1638801_at:106:447; Interrogation_Position=375; Antisense; GATGCTGTACGACCTGCATGTCGAG
>probe:Drosophila_2:1638801_at:220:487; Interrogation_Position=420; Antisense; GTAGCTAGTGATCATGGATTCCGGT
>probe:Drosophila_2:1638801_at:628:9; Interrogation_Position=437; Antisense; ATTCCGGTGTGCGAGTCCAAGTCCT
>probe:Drosophila_2:1638801_at:631:217; Interrogation_Position=455; Antisense; AAGTCCTGGCACAGCCATTTAAGTG
>probe:Drosophila_2:1638801_at:482:505; Interrogation_Position=477; Antisense; GTGCCAACACGAGTTATCTGCAGCA
>probe:Drosophila_2:1638801_at:498:357; Interrogation_Position=499; Antisense; GCAACACTCTCTCTAGGTTCAAAGT
>probe:Drosophila_2:1638801_at:666:169; Interrogation_Position=519; Antisense; AAAGTAATTCGCCTCCGTTCAGTCT
>probe:Drosophila_2:1638801_at:117:645; Interrogation_Position=541; Antisense; TCTTCTCTGCGCACGGATTCGGATA
>probe:Drosophila_2:1638801_at:122:457; Interrogation_Position=562; Antisense; GATATCCGTGTCTGGAGTCACTTGC
>probe:Drosophila_2:1638801_at:454:659; Interrogation_Position=597; Antisense; TAAGCATTGTTTACTTGCATGGCAT
>probe:Drosophila_2:1638801_at:294:35; Interrogation_Position=626; Antisense; ATCACCCCTGATGCATACACATAAT
>probe:Drosophila_2:1638801_at:649:189; Interrogation_Position=706; Antisense; AACTATGTTCATCGGTTACCATCCC
>probe:Drosophila_2:1638801_at:295:541; Interrogation_Position=719; Antisense; GGTTACCATCCCTTCAATATGTATT

Paste this into a BLAST search page for me
GTGTGGCGGCCGGATACGAATACAAGATGCTGTACGACCTGCATGTCGAGGTAGCTAGTGATCATGGATTCCGGTATTCCGGTGTGCGAGTCCAAGTCCTAAGTCCTGGCACAGCCATTTAAGTGGTGCCAACACGAGTTATCTGCAGCAGCAACACTCTCTCTAGGTTCAAAGTAAAGTAATTCGCCTCCGTTCAGTCTTCTTCTCTGCGCACGGATTCGGATAGATATCCGTGTCTGGAGTCACTTGCTAAGCATTGTTTACTTGCATGGCATATCACCCCTGATGCATACACATAATAACTATGTTCATCGGTTACCATCCCGGTTACCATCCCTTCAATATGTATT

Full Affymetrix probeset data:

Annotations for 1638801_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime