FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638802_at:

>probe:Drosophila_2:1638802_at:266:717; Interrogation_Position=113; Antisense; TTCCCAGTGTGATTGGCCCGTTGAA
>probe:Drosophila_2:1638802_at:132:723; Interrogation_Position=133; Antisense; TTGAAGGCTCAACATGTGCGCTTGC
>probe:Drosophila_2:1638802_at:568:623; Interrogation_Position=149; Antisense; TGCGCTTGCCCTTGTTCAGGAAGAA
>probe:Drosophila_2:1638802_at:383:563; Interrogation_Position=167; Antisense; GGAAGAAGTCTACCACCTCAGAGCA
>probe:Drosophila_2:1638802_at:468:255; Interrogation_Position=302; Antisense; CAAAAGCGTGGAACGTGTGGCCCCA
>probe:Drosophila_2:1638802_at:673:201; Interrogation_Position=327; Antisense; AACCTTGCGGCGGACAGCAGTGCAA
>probe:Drosophila_2:1638802_at:611:533; Interrogation_Position=443; Antisense; GGTCCCGGAGGCAGAAATGCTCCCA
>probe:Drosophila_2:1638802_at:47:167; Interrogation_Position=457; Antisense; AAATGCTCCCAATGGCGGTGGTGGA
>probe:Drosophila_2:1638802_at:269:405; Interrogation_Position=49; Antisense; GACTAACTTTCAGTACTCCCAATAC
>probe:Drosophila_2:1638802_at:257:701; Interrogation_Position=496; Antisense; TTTTGGGCTGAGTGCCCCACCAAAC
>probe:Drosophila_2:1638802_at:268:179; Interrogation_Position=517; Antisense; AAACAATCGCGGACCCAAGGCTCTG
>probe:Drosophila_2:1638802_at:362:251; Interrogation_Position=532; Antisense; CAAGGCTCTGGGACTGGCTGCTCTG
>probe:Drosophila_2:1638802_at:213:639; Interrogation_Position=567; Antisense; TCGGCGTCTACCTTACATTAAAAAT
>probe:Drosophila_2:1638802_at:592:627; Interrogation_Position=90; Antisense; TCCAATTTGTCCTATCAGCCTGTTT

Paste this into a BLAST search page for me
TTCCCAGTGTGATTGGCCCGTTGAATTGAAGGCTCAACATGTGCGCTTGCTGCGCTTGCCCTTGTTCAGGAAGAAGGAAGAAGTCTACCACCTCAGAGCACAAAAGCGTGGAACGTGTGGCCCCAAACCTTGCGGCGGACAGCAGTGCAAGGTCCCGGAGGCAGAAATGCTCCCAAAATGCTCCCAATGGCGGTGGTGGAGACTAACTTTCAGTACTCCCAATACTTTTGGGCTGAGTGCCCCACCAAACAAACAATCGCGGACCCAAGGCTCTGCAAGGCTCTGGGACTGGCTGCTCTGTCGGCGTCTACCTTACATTAAAAATTCCAATTTGTCCTATCAGCCTGTTT

Full Affymetrix probeset data:

Annotations for 1638802_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720