Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638803_at:

>probe:Drosophila_2:1638803_at:390:685; Interrogation_Position=2784; Antisense; TATACCCACGACTCTGGTGCGCCAA
>probe:Drosophila_2:1638803_at:472:521; Interrogation_Position=2812; Antisense; GTGGCTGCCAAGAAGCTGCGCTTGC
>probe:Drosophila_2:1638803_at:137:527; Interrogation_Position=2852; Antisense; GGGACATATCATCCACTTCGGCATC
>probe:Drosophila_2:1638803_at:612:569; Interrogation_Position=2871; Antisense; GGCATCCGTCGACGTGGCCATCAAG
>probe:Drosophila_2:1638803_at:219:141; Interrogation_Position=2882; Antisense; ACGTGGCCATCAAGCGCGAGGCTAA
>probe:Drosophila_2:1638803_at:115:211; Interrogation_Position=3071; Antisense; AAGAAGAGGAGATGCCAGCTGCTGT
>probe:Drosophila_2:1638803_at:298:119; Interrogation_Position=3087; Antisense; AGCTGCTGTGCCCAAGTCAAACGAT
>probe:Drosophila_2:1638803_at:608:443; Interrogation_Position=3109; Antisense; GATGACTTTCGCAAGCTATTTCTCA
>probe:Drosophila_2:1638803_at:245:341; Interrogation_Position=3123; Antisense; GCTATTTCTCAAGGATTAGGCGACA
>probe:Drosophila_2:1638803_at:671:705; Interrogation_Position=3138; Antisense; TTAGGCGACAAATGCCGGCGGCTGA
>probe:Drosophila_2:1638803_at:366:313; Interrogation_Position=3170; Antisense; GCCAGCGGCCATGGTTTAGTTTGTA
>probe:Drosophila_2:1638803_at:313:397; Interrogation_Position=3251; Antisense; GACAAGGTTGGAGAACACTGTACAA
>probe:Drosophila_2:1638803_at:216:397; Interrogation_Position=3294; Antisense; GACAATGATTTTTGTTTCGACTCAT
>probe:Drosophila_2:1638803_at:394:479; Interrogation_Position=3307; Antisense; GTTTCGACTCATATAAATTGGTTTC

Paste this into a BLAST search page for me
TATACCCACGACTCTGGTGCGCCAAGTGGCTGCCAAGAAGCTGCGCTTGCGGGACATATCATCCACTTCGGCATCGGCATCCGTCGACGTGGCCATCAAGACGTGGCCATCAAGCGCGAGGCTAAAAGAAGAGGAGATGCCAGCTGCTGTAGCTGCTGTGCCCAAGTCAAACGATGATGACTTTCGCAAGCTATTTCTCAGCTATTTCTCAAGGATTAGGCGACATTAGGCGACAAATGCCGGCGGCTGAGCCAGCGGCCATGGTTTAGTTTGTAGACAAGGTTGGAGAACACTGTACAAGACAATGATTTTTGTTTCGACTCATGTTTCGACTCATATAAATTGGTTTC

Full Affymetrix probeset data:

Annotations for 1638803_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime