Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638804_a_at:

>probe:Drosophila_2:1638804_a_at:639:227; Interrogation_Position=108; Antisense; AATGGCATGATTGGAACGGTTTACA
>probe:Drosophila_2:1638804_a_at:422:217; Interrogation_Position=172; Antisense; AAGTTTCTATGGATCAGCCAATGGA
>probe:Drosophila_2:1638804_a_at:621:709; Interrogation_Position=225; Antisense; TTAACTGTTCGTCGGCTTCAACATA
>probe:Drosophila_2:1638804_a_at:202:259; Interrogation_Position=260; Antisense; CACTATCGTCAGTTGTTTTTTGTAC
>probe:Drosophila_2:1638804_a_at:439:539; Interrogation_Position=290; Antisense; GGTTTCCGGAAGTTGCAATAGCACT
>probe:Drosophila_2:1638804_a_at:480:223; Interrogation_Position=322; Antisense; AAGGATGTATTATCAGCACTTACTT
>probe:Drosophila_2:1638804_a_at:139:357; Interrogation_Position=337; Antisense; GCACTTACTTATATTCACTCCGAGC
>probe:Drosophila_2:1638804_a_at:619:711; Interrogation_Position=350; Antisense; TTCACTCCGAGCATTATGTTCATGG
>probe:Drosophila_2:1638804_a_at:643:647; Interrogation_Position=369; Antisense; TCATGGATCAGTAAGGGCTAAGCAC
>probe:Drosophila_2:1638804_a_at:399:209; Interrogation_Position=388; Antisense; AAGCACATACTCTTAAGTCCCAGAA
>probe:Drosophila_2:1638804_a_at:239:557; Interrogation_Position=518; Antisense; GGACAGCACCAGAAGTTTTATATCA
>probe:Drosophila_2:1638804_a_at:340:27; Interrogation_Position=539; Antisense; ATCAAAACCTTTCTGGTTACACTGA
>probe:Drosophila_2:1638804_a_at:692:7; Interrogation_Position=578; Antisense; ATTCCATCGGAATTACTTGTTGCGA
>probe:Drosophila_2:1638804_a_at:510:13; Interrogation_Position=73; Antisense; ATATATCTGACTACAAACTGCTAGA

Paste this into a BLAST search page for me
AATGGCATGATTGGAACGGTTTACAAAGTTTCTATGGATCAGCCAATGGATTAACTGTTCGTCGGCTTCAACATACACTATCGTCAGTTGTTTTTTGTACGGTTTCCGGAAGTTGCAATAGCACTAAGGATGTATTATCAGCACTTACTTGCACTTACTTATATTCACTCCGAGCTTCACTCCGAGCATTATGTTCATGGTCATGGATCAGTAAGGGCTAAGCACAAGCACATACTCTTAAGTCCCAGAAGGACAGCACCAGAAGTTTTATATCAATCAAAACCTTTCTGGTTACACTGAATTCCATCGGAATTACTTGTTGCGAATATATCTGACTACAAACTGCTAGA

Full Affymetrix probeset data:

Annotations for 1638804_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime