Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638805_at:

>probe:Drosophila_2:1638805_at:246:147; Interrogation_Position=1538; Antisense; ACTAAGCCTGGAATGTCACACAATA
>probe:Drosophila_2:1638805_at:694:639; Interrogation_Position=1579; Antisense; TCGGAGATTGCCCACTGAGACAGAA
>probe:Drosophila_2:1638805_at:599:403; Interrogation_Position=1688; Antisense; GACTAAAGCCTATTTGGTAATGCCA
>probe:Drosophila_2:1638805_at:12:369; Interrogation_Position=1716; Antisense; GAATGCTCAAGTCAAATCCCGATGC
>probe:Drosophila_2:1638805_at:250:457; Interrogation_Position=1802; Antisense; GATAGAACTTGACTTCCGCCTCGAC
>probe:Drosophila_2:1638805_at:706:153; Interrogation_Position=1827; Antisense; ACAGTCCTTGAGCAGTTCGTCCAGC
>probe:Drosophila_2:1638805_at:547:495; Interrogation_Position=1854; Antisense; GTCACTGGCGTGATCCTGCAGAGAG
>probe:Drosophila_2:1638805_at:487:23; Interrogation_Position=1881; Antisense; ATAGTTATTTAGCTCGTCCACGCAG
>probe:Drosophila_2:1638805_at:522:267; Interrogation_Position=1903; Antisense; CAGGAGAGCTCCAAGCTGCGCAAGT
>probe:Drosophila_2:1638805_at:370:83; Interrogation_Position=1955; Antisense; AGTGTAGCTTGTGCAGCAACGTCAA
>probe:Drosophila_2:1638805_at:305:275; Interrogation_Position=1991; Antisense; CTTGCACTTGGGTTAGCGGCGAGAT
>probe:Drosophila_2:1638805_at:268:343; Interrogation_Position=2042; Antisense; GCTTAAACACAGACTCGGCGGCATT
>probe:Drosophila_2:1638805_at:500:593; Interrogation_Position=2066; Antisense; TGGGCGTCCCGGTGAACCAATGGCA
>probe:Drosophila_2:1638805_at:538:379; Interrogation_Position=2079; Antisense; GAACCAATGGCATGAGATTCCCTTC

Paste this into a BLAST search page for me
ACTAAGCCTGGAATGTCACACAATATCGGAGATTGCCCACTGAGACAGAAGACTAAAGCCTATTTGGTAATGCCAGAATGCTCAAGTCAAATCCCGATGCGATAGAACTTGACTTCCGCCTCGACACAGTCCTTGAGCAGTTCGTCCAGCGTCACTGGCGTGATCCTGCAGAGAGATAGTTATTTAGCTCGTCCACGCAGCAGGAGAGCTCCAAGCTGCGCAAGTAGTGTAGCTTGTGCAGCAACGTCAACTTGCACTTGGGTTAGCGGCGAGATGCTTAAACACAGACTCGGCGGCATTTGGGCGTCCCGGTGAACCAATGGCAGAACCAATGGCATGAGATTCCCTTC

Full Affymetrix probeset data:

Annotations for 1638805_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime