Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638806_at:

>probe:Drosophila_2:1638806_at:213:379; Interrogation_Position=2119; Antisense; GAAGCGCTTACCGAGAGGTTAGCTT
>probe:Drosophila_2:1638806_at:223:705; Interrogation_Position=2137; Antisense; TTAGCTTGGGCAATGGTCAGACCGC
>probe:Drosophila_2:1638806_at:351:537; Interrogation_Position=2151; Antisense; GGTCAGACCGCTGATATTATCACTT
>probe:Drosophila_2:1638806_at:146:217; Interrogation_Position=2198; Antisense; AAGTATGGGCAACTATGGCCGCCAC
>probe:Drosophila_2:1638806_at:596:577; Interrogation_Position=2214; Antisense; GGCCGCCACCTGGAGTGTGCGCAAA
>probe:Drosophila_2:1638806_at:97:325; Interrogation_Position=2232; Antisense; GCGCAAACACGCAAGTCACTGGAAG
>probe:Drosophila_2:1638806_at:523:425; Interrogation_Position=2312; Antisense; GAGAGCCAACATCAGCATATCTTCA
>probe:Drosophila_2:1638806_at:394:531; Interrogation_Position=2350; Antisense; GGGTATGCCAAAGTGGCTCCTGCTC
>probe:Drosophila_2:1638806_at:469:173; Interrogation_Position=2419; Antisense; AAAGCTCGCCCAACGTAAAGCGTGC
>probe:Drosophila_2:1638806_at:11:123; Interrogation_Position=2437; Antisense; AGCGTGCTGCTTCGAGTAACGACTT
>probe:Drosophila_2:1638806_at:113:455; Interrogation_Position=2471; Antisense; GATCAAGCGACCAAACATCCTGCGG
>probe:Drosophila_2:1638806_at:516:503; Interrogation_Position=2497; Antisense; GTCGCCAGCTTTCAGTGATCTAATA
>probe:Drosophila_2:1638806_at:331:663; Interrogation_Position=2539; Antisense; TAAATACTTGGCTGCATTTTACGCA
>probe:Drosophila_2:1638806_at:348:559; Interrogation_Position=2678; Antisense; GGAATAACTGCCACTCGTAGTTTAA

Paste this into a BLAST search page for me
GAAGCGCTTACCGAGAGGTTAGCTTTTAGCTTGGGCAATGGTCAGACCGCGGTCAGACCGCTGATATTATCACTTAAGTATGGGCAACTATGGCCGCCACGGCCGCCACCTGGAGTGTGCGCAAAGCGCAAACACGCAAGTCACTGGAAGGAGAGCCAACATCAGCATATCTTCAGGGTATGCCAAAGTGGCTCCTGCTCAAAGCTCGCCCAACGTAAAGCGTGCAGCGTGCTGCTTCGAGTAACGACTTGATCAAGCGACCAAACATCCTGCGGGTCGCCAGCTTTCAGTGATCTAATATAAATACTTGGCTGCATTTTACGCAGGAATAACTGCCACTCGTAGTTTAA

Full Affymetrix probeset data:

Annotations for 1638806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime