Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638808_at:

>probe:Drosophila_2:1638808_at:616:697; Interrogation_Position=1092; Antisense; TTTTCTATGGACTCCACCAGACTTT
>probe:Drosophila_2:1638808_at:519:403; Interrogation_Position=1111; Antisense; GACTTTCATCAATCTGTGGCACAAA
>probe:Drosophila_2:1638808_at:160:183; Interrogation_Position=1134; Antisense; AAAACGAACTATTCCTGCAGAACTA
>probe:Drosophila_2:1638808_at:473:193; Interrogation_Position=1260; Antisense; AACTCTTTGTGGATAATTTTCTGCA
>probe:Drosophila_2:1638808_at:445:225; Interrogation_Position=1295; Antisense; AAGGAGCGGCAGACACTGCGCGAAA
>probe:Drosophila_2:1638808_at:551:65; Interrogation_Position=1322; Antisense; ATGGATCGATTCAACGAGCTGCGCC
>probe:Drosophila_2:1638808_at:653:109; Interrogation_Position=1353; Antisense; AGAAGTCCATCGAGGAGGTGCACGC
>probe:Drosophila_2:1638808_at:480:51; Interrogation_Position=1385; Antisense; ATGCGCATCCAGACCCTGGTAATGG
>probe:Drosophila_2:1638808_at:543:121; Interrogation_Position=1428; Antisense; AGCGGGTGGAGTTTCACGCCCAGCA
>probe:Drosophila_2:1638808_at:132:587; Interrogation_Position=1488; Antisense; TGGACCAGGCGGAGCAGCACCAGAA
>probe:Drosophila_2:1638808_at:492:655; Interrogation_Position=1533; Antisense; TAATGCTCATCGTGATACTCGCAGC
>probe:Drosophila_2:1638808_at:314:145; Interrogation_Position=1549; Antisense; ACTCGCAGCCGTGTTGCTAGTATTA
>probe:Drosophila_2:1638808_at:443:617; Interrogation_Position=1563; Antisense; TGCTAGTATTACTCCTTGTTGGTAT
>probe:Drosophila_2:1638808_at:555:513; Interrogation_Position=1594; Antisense; GTGATGCACGCGAGAAACTTTATTT

Paste this into a BLAST search page for me
TTTTCTATGGACTCCACCAGACTTTGACTTTCATCAATCTGTGGCACAAAAAAACGAACTATTCCTGCAGAACTAAACTCTTTGTGGATAATTTTCTGCAAAGGAGCGGCAGACACTGCGCGAAAATGGATCGATTCAACGAGCTGCGCCAGAAGTCCATCGAGGAGGTGCACGCATGCGCATCCAGACCCTGGTAATGGAGCGGGTGGAGTTTCACGCCCAGCATGGACCAGGCGGAGCAGCACCAGAATAATGCTCATCGTGATACTCGCAGCACTCGCAGCCGTGTTGCTAGTATTATGCTAGTATTACTCCTTGTTGGTATGTGATGCACGCGAGAAACTTTATTT

Full Affymetrix probeset data:

Annotations for 1638808_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime