FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638810_at:

>probe:Drosophila_2:1638810_at:342:547; Interrogation_Position=1011; Antisense; TCGAGGTGTCTTTGAAACCCGCCGA
>probe:Drosophila_2:1638810_at:645:689; Interrogation_Position=1079; Antisense; TATTGGACTCCACTGCAGCAAATCG
>probe:Drosophila_2:1638810_at:5:89; Interrogation_Position=1114; Antisense; AGTCACCGGTTGTAATCTGCGTCCT
>probe:Drosophila_2:1638810_at:381:591; Interrogation_Position=1138; Antisense; TGGTGATCTGATGGCCTCCGGAACG
>probe:Drosophila_2:1638810_at:280:511; Interrogation_Position=1170; Antisense; GTGAGACTCCAGACTCGTACGGATC
>probe:Drosophila_2:1638810_at:392:489; Interrogation_Position=1186; Antisense; GTACGGATCACTTTTAGAGCTCTGC
>probe:Drosophila_2:1638810_at:214:103; Interrogation_Position=1201; Antisense; AGAGCTCTGCTGGAAGGGCACCAAA
>probe:Drosophila_2:1638810_at:618:403; Interrogation_Position=1268; Antisense; GACTTTGACGAGGTCATCATCCGTG
>probe:Drosophila_2:1638810_at:28:37; Interrogation_Position=1283; Antisense; ATCATCCGTGGCCACTGCGAAAAGA
>probe:Drosophila_2:1638810_at:178:291; Interrogation_Position=1363; Antisense; CGTTCCGCAGTAGGACCACTTATTA
>probe:Drosophila_2:1638810_at:180:247; Interrogation_Position=1406; Antisense; AATTCTATTCAGTCTTCCTGGATAC
>probe:Drosophila_2:1638810_at:397:379; Interrogation_Position=922; Antisense; GAAGCCCTTCGTCTTGGACAACTTT
>probe:Drosophila_2:1638810_at:367:643; Interrogation_Position=949; Antisense; TCAGGAACCGGAGGTGCTTCCCTAT
>probe:Drosophila_2:1638810_at:240:293; Interrogation_Position=977; Antisense; CGCCAGAACATTCCCTTTAACTTTG

Paste this into a BLAST search page for me
TCGAGGTGTCTTTGAAACCCGCCGATATTGGACTCCACTGCAGCAAATCGAGTCACCGGTTGTAATCTGCGTCCTTGGTGATCTGATGGCCTCCGGAACGGTGAGACTCCAGACTCGTACGGATCGTACGGATCACTTTTAGAGCTCTGCAGAGCTCTGCTGGAAGGGCACCAAAGACTTTGACGAGGTCATCATCCGTGATCATCCGTGGCCACTGCGAAAAGACGTTCCGCAGTAGGACCACTTATTAAATTCTATTCAGTCTTCCTGGATACGAAGCCCTTCGTCTTGGACAACTTTTCAGGAACCGGAGGTGCTTCCCTATCGCCAGAACATTCCCTTTAACTTTG

Full Affymetrix probeset data:

Annotations for 1638810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720