FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638811_at:

>probe:Drosophila_2:1638811_at:534:97; Interrogation_Position=2218; Antisense; AGATCTTCGGAATTGGTGCCTTCAT
>probe:Drosophila_2:1638811_at:717:505; Interrogation_Position=2233; Antisense; GTGCCTTCATTGTCTTTGTGATCCA
>probe:Drosophila_2:1638811_at:713:605; Interrogation_Position=2251; Antisense; TGATCCACGTTTGCATCCAGCTGTA
>probe:Drosophila_2:1638811_at:152:1; Interrogation_Position=2304; Antisense; AATGGTAAGGGTACGGTCGCTTCTG
>probe:Drosophila_2:1638811_at:119:355; Interrogation_Position=2352; Antisense; GCACCCTTGGAGACAGACATTCCTA
>probe:Drosophila_2:1638811_at:615:405; Interrogation_Position=2400; Antisense; GACGGGTTTCGCGAAGTCGACTTGA
>probe:Drosophila_2:1638811_at:16:633; Interrogation_Position=2416; Antisense; TCGACTTGAGTTGATGGTGACCGTG
>probe:Drosophila_2:1638811_at:231:509; Interrogation_Position=2432; Antisense; GTGACCGTGATTGTCTTCCTGAATT
>probe:Drosophila_2:1638811_at:531:177; Interrogation_Position=2492; Antisense; AAACTAACCAGAAGCTAGCGCCCTT
>probe:Drosophila_2:1638811_at:319:341; Interrogation_Position=2505; Antisense; GCTAGCGCCCTTAAGTATTATCCAT
>probe:Drosophila_2:1638811_at:94:233; Interrogation_Position=2533; Antisense; AATGCAGTGGATACGCTGGCCATTG
>probe:Drosophila_2:1638811_at:389:575; Interrogation_Position=2550; Antisense; GGCCATTGTACTTAAACCACCATAT
>probe:Drosophila_2:1638811_at:463:599; Interrogation_Position=2658; Antisense; TGTCGTCCTATGAAATAAGCTTTGT
>probe:Drosophila_2:1638811_at:493:457; Interrogation_Position=2702; Antisense; GATAGCCATATCATACTTTTTCAAT

Paste this into a BLAST search page for me
AGATCTTCGGAATTGGTGCCTTCATGTGCCTTCATTGTCTTTGTGATCCATGATCCACGTTTGCATCCAGCTGTAAATGGTAAGGGTACGGTCGCTTCTGGCACCCTTGGAGACAGACATTCCTAGACGGGTTTCGCGAAGTCGACTTGATCGACTTGAGTTGATGGTGACCGTGGTGACCGTGATTGTCTTCCTGAATTAAACTAACCAGAAGCTAGCGCCCTTGCTAGCGCCCTTAAGTATTATCCATAATGCAGTGGATACGCTGGCCATTGGGCCATTGTACTTAAACCACCATATTGTCGTCCTATGAAATAAGCTTTGTGATAGCCATATCATACTTTTTCAAT

Full Affymetrix probeset data:

Annotations for 1638811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720