FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638812_at:

>probe:Drosophila_2:1638812_at:239:25; Interrogation_Position=121; Antisense; ACCTCCCGGGAGCTGGTGGAATTCA
>probe:Drosophila_2:1638812_at:563:283; Interrogation_Position=162; Antisense; CTGCGAGGCTGTGCGTGCAATCGAA
>probe:Drosophila_2:1638812_at:499:93; Interrogation_Position=18; Antisense; AGTTCTCCCAGTAAATCCAATCATG
>probe:Drosophila_2:1638812_at:437:389; Interrogation_Position=184; Antisense; GAAAACTATCCCAACGGCTGCGAAG
>probe:Drosophila_2:1638812_at:28:221; Interrogation_Position=206; Antisense; AAGTGACGATCTGCGCCGATGGTGT
>probe:Drosophila_2:1638812_at:678:331; Interrogation_Position=251; Antisense; GCGGCCAGGGATCGTGCAACATCTT
>probe:Drosophila_2:1638812_at:148:191; Interrogation_Position=268; Antisense; AACATCTTCGGCTGCAACTGCGACG
>probe:Drosophila_2:1638812_at:19:419; Interrogation_Position=303; Antisense; GAGCGGCGATTGGTCACAGGAATTT
>probe:Drosophila_2:1638812_at:627:379; Interrogation_Position=336; Antisense; GAACCAGCAGTACGGAATCCAGATC
>probe:Drosophila_2:1638812_at:695:247; Interrogation_Position=35; Antisense; CAATCATGGCATCCCCAGTAGTCAG
>probe:Drosophila_2:1638812_at:426:97; Interrogation_Position=356; Antisense; AGATCATCAAAGTCACCAGGCTGCC
>probe:Drosophila_2:1638812_at:442:701; Interrogation_Position=382; Antisense; TTTTAACCCCTTGCATCACATAAAC
>probe:Drosophila_2:1638812_at:432:679; Interrogation_Position=53; Antisense; TAGTCAGCCTGCTTCTCGTCGGGAT
>probe:Drosophila_2:1638812_at:602:269; Interrogation_Position=97; Antisense; CATGTGGCTCGGTCGGAATGCTGCA

Paste this into a BLAST search page for me
ACCTCCCGGGAGCTGGTGGAATTCACTGCGAGGCTGTGCGTGCAATCGAAAGTTCTCCCAGTAAATCCAATCATGGAAAACTATCCCAACGGCTGCGAAGAAGTGACGATCTGCGCCGATGGTGTGCGGCCAGGGATCGTGCAACATCTTAACATCTTCGGCTGCAACTGCGACGGAGCGGCGATTGGTCACAGGAATTTGAACCAGCAGTACGGAATCCAGATCCAATCATGGCATCCCCAGTAGTCAGAGATCATCAAAGTCACCAGGCTGCCTTTTAACCCCTTGCATCACATAAACTAGTCAGCCTGCTTCTCGTCGGGATCATGTGGCTCGGTCGGAATGCTGCA

Full Affymetrix probeset data:

Annotations for 1638812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720