FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638815_at:

>probe:Drosophila_2:1638815_at:730:131; Interrogation_Position=101; Antisense; ACCCCAATGTCACTGGATGCATCGA
>probe:Drosophila_2:1638815_at:620:57; Interrogation_Position=13; Antisense; ATGAGGGCCACATCGATCATCTTAT
>probe:Drosophila_2:1638815_at:300:267; Interrogation_Position=135; Antisense; CAGTCCAAGCGATCCGGAGTGCGTG
>probe:Drosophila_2:1638815_at:30:579; Interrogation_Position=158; Antisense; TGGCTGAGGCCGCTAATACCACTAC
>probe:Drosophila_2:1638815_at:643:653; Interrogation_Position=171; Antisense; TAATACCACTACGAAACCCGCAGAT
>probe:Drosophila_2:1638815_at:351:441; Interrogation_Position=193; Antisense; GATGGAACAGATACCACGACACCCA
>probe:Drosophila_2:1638815_at:132:129; Interrogation_Position=217; Antisense; ACCACAGGAGGAAGCACCGATGCGA
>probe:Drosophila_2:1638815_at:155:575; Interrogation_Position=246; Antisense; GGCGGGATCTACAACGCCTACTTCG
>probe:Drosophila_2:1638815_at:464:453; Interrogation_Position=27; Antisense; GATCATCTTATCAGGAGTTCTTGTC
>probe:Drosophila_2:1638815_at:273:181; Interrogation_Position=348; Antisense; AAACAACGCGGCTGCTGTGGCCAGA
>probe:Drosophila_2:1638815_at:349:77; Interrogation_Position=39; Antisense; AGGAGTTCTTGTCCTGGTCGCTTGC
>probe:Drosophila_2:1638815_at:451:337; Interrogation_Position=403; Antisense; GCTCAAAGGAGGAGGCGTGCACAAA
>probe:Drosophila_2:1638815_at:579:347; Interrogation_Position=464; Antisense; GCAGGAGGCAAAACCAATCGGGCTA
>probe:Drosophila_2:1638815_at:417:287; Interrogation_Position=52; Antisense; CTGGTCGCTTGCCTATTGAGGAGTA

Paste this into a BLAST search page for me
ACCCCAATGTCACTGGATGCATCGAATGAGGGCCACATCGATCATCTTATCAGTCCAAGCGATCCGGAGTGCGTGTGGCTGAGGCCGCTAATACCACTACTAATACCACTACGAAACCCGCAGATGATGGAACAGATACCACGACACCCAACCACAGGAGGAAGCACCGATGCGAGGCGGGATCTACAACGCCTACTTCGGATCATCTTATCAGGAGTTCTTGTCAAACAACGCGGCTGCTGTGGCCAGAAGGAGTTCTTGTCCTGGTCGCTTGCGCTCAAAGGAGGAGGCGTGCACAAAGCAGGAGGCAAAACCAATCGGGCTACTGGTCGCTTGCCTATTGAGGAGTA

Full Affymetrix probeset data:

Annotations for 1638815_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720