FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638817_at:

>probe:Drosophila_2:1638817_at:700:609; Interrogation_Position=2686; Antisense; TGACTGCGCTTAGTTCCGAGACACG
>probe:Drosophila_2:1638817_at:28:425; Interrogation_Position=2703; Antisense; GAGACACGCGCTTGCATTTGAATGT
>probe:Drosophila_2:1638817_at:389:645; Interrogation_Position=2727; Antisense; TCTTTGGACGCCCTCTGAATATATA
>probe:Drosophila_2:1638817_at:304:99; Interrogation_Position=2789; Antisense; AGAGTTACACATGTGCGGGCCACCC
>probe:Drosophila_2:1638817_at:386:523; Interrogation_Position=2805; Antisense; GGGCCACCCAGATAAGTCCATTTGT
>probe:Drosophila_2:1638817_at:36:33; Interrogation_Position=2816; Antisense; ATAAGTCCATTTGTCTCGTCTGGGC
>probe:Drosophila_2:1638817_at:167:595; Interrogation_Position=2836; Antisense; TGGGCCACGCCTAATTCAGTTTGGG
>probe:Drosophila_2:1638817_at:553:643; Interrogation_Position=2851; Antisense; TCAGTTTGGGCGTTATTCAATTTCC
>probe:Drosophila_2:1638817_at:689:489; Interrogation_Position=2886; Antisense; GTACTTCCATCTAGGCAACTTGTGT
>probe:Drosophila_2:1638817_at:217:689; Interrogation_Position=2934; Antisense; TATTCGCTGCCACCCTAATATTGGT
>probe:Drosophila_2:1638817_at:352:687; Interrogation_Position=2990; Antisense; TATACATTGCAGACCATCAGCCAGC
>probe:Drosophila_2:1638817_at:282:313; Interrogation_Position=3009; Antisense; GCCAGCGGGCGTTGTCGGAAATTTA
>probe:Drosophila_2:1638817_at:97:647; Interrogation_Position=3135; Antisense; TCATTGAGTCTGCTCTGGACACACA
>probe:Drosophila_2:1638817_at:728:103; Interrogation_Position=3170; Antisense; AATTTTGCGGCATCGGTAGGTTAAT

Paste this into a BLAST search page for me
TGACTGCGCTTAGTTCCGAGACACGGAGACACGCGCTTGCATTTGAATGTTCTTTGGACGCCCTCTGAATATATAAGAGTTACACATGTGCGGGCCACCCGGGCCACCCAGATAAGTCCATTTGTATAAGTCCATTTGTCTCGTCTGGGCTGGGCCACGCCTAATTCAGTTTGGGTCAGTTTGGGCGTTATTCAATTTCCGTACTTCCATCTAGGCAACTTGTGTTATTCGCTGCCACCCTAATATTGGTTATACATTGCAGACCATCAGCCAGCGCCAGCGGGCGTTGTCGGAAATTTATCATTGAGTCTGCTCTGGACACACAAATTTTGCGGCATCGGTAGGTTAAT

Full Affymetrix probeset data:

Annotations for 1638817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720