FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638818_at:

>probe:Drosophila_2:1638818_at:164:361; Interrogation_Position=137; Antisense; GCAAGTCGGTCTACGCTGCCGAGGA
>probe:Drosophila_2:1638818_at:524:123; Interrogation_Position=161; Antisense; AGCGCGTTGCCGGAGGCTACAAATT
>probe:Drosophila_2:1638818_at:132:339; Interrogation_Position=176; Antisense; GCTACAAATTCCACAAGACCTGCTT
>probe:Drosophila_2:1638818_at:444:679; Interrogation_Position=18; Antisense; TAGTCCGCGGCATTTCCGACGAATA
>probe:Drosophila_2:1638818_at:193:115; Interrogation_Position=208; Antisense; AGCATGTGCAACAAGGCCCTGGACT
>probe:Drosophila_2:1638818_at:455:421; Interrogation_Position=247; Antisense; GAGCACGAGAAGGAGCTTTTCTGCA
>probe:Drosophila_2:1638818_at:523:553; Interrogation_Position=258; Antisense; GGAGCTTTTCTGCAAAAACTGCCAT
>probe:Drosophila_2:1638818_at:77:179; Interrogation_Position=273; Antisense; AAACTGCCATGGTCGCAAATACGGT
>probe:Drosophila_2:1638818_at:393:501; Interrogation_Position=284; Antisense; GTCGCAAATACGGTCCCAAGGGATA
>probe:Drosophila_2:1638818_at:358:141; Interrogation_Position=346; Antisense; ACTGGCGCCCACTTAAACAGAGAGT
>probe:Drosophila_2:1638818_at:683:61; Interrogation_Position=428; Antisense; ATGTGTAGTTTTGCTTTCTATTAGA
>probe:Drosophila_2:1638818_at:95:385; Interrogation_Position=44; Antisense; GAACTACTTCACAGAGTACCTCCGA
>probe:Drosophila_2:1638818_at:199:99; Interrogation_Position=56; Antisense; AGAGTACCTCCGAGACACACACACG
>probe:Drosophila_2:1638818_at:84:87; Interrogation_Position=86; Antisense; AGATCAAAATGCCTTTCGTTCCCGT

Paste this into a BLAST search page for me
GCAAGTCGGTCTACGCTGCCGAGGAAGCGCGTTGCCGGAGGCTACAAATTGCTACAAATTCCACAAGACCTGCTTTAGTCCGCGGCATTTCCGACGAATAAGCATGTGCAACAAGGCCCTGGACTGAGCACGAGAAGGAGCTTTTCTGCAGGAGCTTTTCTGCAAAAACTGCCATAAACTGCCATGGTCGCAAATACGGTGTCGCAAATACGGTCCCAAGGGATAACTGGCGCCCACTTAAACAGAGAGTATGTGTAGTTTTGCTTTCTATTAGAGAACTACTTCACAGAGTACCTCCGAAGAGTACCTCCGAGACACACACACGAGATCAAAATGCCTTTCGTTCCCGT

Full Affymetrix probeset data:

Annotations for 1638818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720