FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638819_at:

>probe:Drosophila_2:1638819_at:622:419; Interrogation_Position=1005; Antisense; GAGCAGAAGGTCATATTAGGCAAAA
>probe:Drosophila_2:1638819_at:549:181; Interrogation_Position=1027; Antisense; AAAACAATTCCAGGCCCAAGCTATC
>probe:Drosophila_2:1638819_at:519:203; Interrogation_Position=1044; Antisense; AAGCTATCGTTCTCCCTGAAACCGG
>probe:Drosophila_2:1638819_at:36:203; Interrogation_Position=1063; Antisense; AACCGGGCGCATTATGAGGAGCGTA
>probe:Drosophila_2:1638819_at:650:327; Interrogation_Position=1083; Antisense; GCGTAGGCATCAGTCTGGTGACCGT
>probe:Drosophila_2:1638819_at:493:499; Interrogation_Position=1106; Antisense; GTCGCACCTTTTCTTGTTAACAGCT
>probe:Drosophila_2:1638819_at:407:699; Interrogation_Position=1141; Antisense; TTTTTACCTCAGTGGCTATTTGCCT
>probe:Drosophila_2:1638819_at:581:19; Interrogation_Position=1158; Antisense; ATTTGCCTGCGACACAGACCATGCA
>probe:Drosophila_2:1638819_at:712:413; Interrogation_Position=1174; Antisense; GACCATGCACTCGTTTTCATTGTTG
>probe:Drosophila_2:1638819_at:548:111; Interrogation_Position=1261; Antisense; AGCACAGCCAATAGATTCAACGTTT
>probe:Drosophila_2:1638819_at:235:15; Interrogation_Position=1298; Antisense; ATTACTGAACACATACGGCTCTATA
>probe:Drosophila_2:1638819_at:104:673; Interrogation_Position=1331; Antisense; TACGCTAGCGATTTACTTAACCTTT
>probe:Drosophila_2:1638819_at:403:231; Interrogation_Position=1384; Antisense; AATGATTATGTGTAGTGCGTCGTAT
>probe:Drosophila_2:1638819_at:90:329; Interrogation_Position=1400; Antisense; GCGTCGTATTGTTGTCACAGCTGAA

Paste this into a BLAST search page for me
GAGCAGAAGGTCATATTAGGCAAAAAAAACAATTCCAGGCCCAAGCTATCAAGCTATCGTTCTCCCTGAAACCGGAACCGGGCGCATTATGAGGAGCGTAGCGTAGGCATCAGTCTGGTGACCGTGTCGCACCTTTTCTTGTTAACAGCTTTTTTACCTCAGTGGCTATTTGCCTATTTGCCTGCGACACAGACCATGCAGACCATGCACTCGTTTTCATTGTTGAGCACAGCCAATAGATTCAACGTTTATTACTGAACACATACGGCTCTATATACGCTAGCGATTTACTTAACCTTTAATGATTATGTGTAGTGCGTCGTATGCGTCGTATTGTTGTCACAGCTGAA

Full Affymetrix probeset data:

Annotations for 1638819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720