Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638820_at:

>probe:Drosophila_2:1638820_at:608:617; Interrogation_Position=1932; Antisense; TGCAGGGCATACAGGGCTATCACTT
>probe:Drosophila_2:1638820_at:308:681; Interrogation_Position=1949; Antisense; TATCACTTCGGCCAGTACGGCGGAT
>probe:Drosophila_2:1638820_at:182:671; Interrogation_Position=1964; Antisense; TACGGCGGATATCAGCAGGGATACA
>probe:Drosophila_2:1638820_at:149:65; Interrogation_Position=1994; Antisense; ATGGGAGTGCAGATTCCGGCCACCT
>probe:Drosophila_2:1638820_at:390:585; Interrogation_Position=2018; Antisense; TGGCAAGGCGTCACCCAGGCGCAGA
>probe:Drosophila_2:1638820_at:141:685; Interrogation_Position=2114; Antisense; TATCCGATCCAGCAGTTCCAAGTGA
>probe:Drosophila_2:1638820_at:137:79; Interrogation_Position=2145; Antisense; AGGTTTATCCTCTACTCTTGCAGGC
>probe:Drosophila_2:1638820_at:337:491; Interrogation_Position=2219; Antisense; GTACAGCCGCAATTTTCTGAACAGA
>probe:Drosophila_2:1638820_at:338:51; Interrogation_Position=2272; Antisense; ATGCGAAGCGCAGAACACACAAATT
>probe:Drosophila_2:1638820_at:145:441; Interrogation_Position=2308; Antisense; GATGGCATCTTGAAGTTTGGCAATT
>probe:Drosophila_2:1638820_at:501:565; Interrogation_Position=2326; Antisense; GGCAATTTTAGAGAGCTGCACCTCA
>probe:Drosophila_2:1638820_at:244:165; Interrogation_Position=2383; Antisense; AAATCCCACACCCACATAAATATAT
>probe:Drosophila_2:1638820_at:446:345; Interrogation_Position=2435; Antisense; GCATAATTATCTGTCAACGCCCGTT
>probe:Drosophila_2:1638820_at:690:649; Interrogation_Position=2448; Antisense; TCAACGCCCGTTGAAAAAGCTTCGG

Paste this into a BLAST search page for me
TGCAGGGCATACAGGGCTATCACTTTATCACTTCGGCCAGTACGGCGGATTACGGCGGATATCAGCAGGGATACAATGGGAGTGCAGATTCCGGCCACCTTGGCAAGGCGTCACCCAGGCGCAGATATCCGATCCAGCAGTTCCAAGTGAAGGTTTATCCTCTACTCTTGCAGGCGTACAGCCGCAATTTTCTGAACAGAATGCGAAGCGCAGAACACACAAATTGATGGCATCTTGAAGTTTGGCAATTGGCAATTTTAGAGAGCTGCACCTCAAAATCCCACACCCACATAAATATATGCATAATTATCTGTCAACGCCCGTTTCAACGCCCGTTGAAAAAGCTTCGG

Full Affymetrix probeset data:

Annotations for 1638820_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime