FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638822_at:

>probe:Drosophila_2:1638822_at:433:319; Interrogation_Position=1028; Antisense; GCCGCTGCTGCAAAAGATGGTCAAC
>probe:Drosophila_2:1638822_at:138:591; Interrogation_Position=1045; Antisense; TGGTCAACGAGACGCTGGATCTGTT
>probe:Drosophila_2:1638822_at:261:517; Interrogation_Position=1092; Antisense; GTGTGCTCGCACAATGTAAGCCGTG
>probe:Drosophila_2:1638822_at:450:205; Interrogation_Position=1109; Antisense; AAGCCGTGGTTTTGTGCTGGCCTGC
>probe:Drosophila_2:1638822_at:84:65; Interrogation_Position=1152; Antisense; ATGGGCGAAACTTTGCAGCATCTGC
>probe:Drosophila_2:1638822_at:389:191; Interrogation_Position=1281; Antisense; AACTTGCTGAACATCAACCGAGTGC
>probe:Drosophila_2:1638822_at:309:201; Interrogation_Position=1296; Antisense; AACCGAGTGCTGTTGGCGTTGGCAA
>probe:Drosophila_2:1638822_at:115:467; Interrogation_Position=1313; Antisense; GTTGGCAAAGCTCATTCCTATCATC
>probe:Drosophila_2:1638822_at:537:685; Interrogation_Position=1331; Antisense; TATCATCAGTGGTCTCACCTCGAGA
>probe:Drosophila_2:1638822_at:703:99; Interrogation_Position=1353; Antisense; AGAGGCTTCGATACCACTTCGCGAC
>probe:Drosophila_2:1638822_at:104:661; Interrogation_Position=1402; Antisense; TAACCTTCTACGTGGTCGCCGAGAA
>probe:Drosophila_2:1638822_at:568:391; Interrogation_Position=1455; Antisense; GAAAGCTTTAGCTCCGCTTAGAGGA
>probe:Drosophila_2:1638822_at:451:617; Interrogation_Position=1498; Antisense; TGCATCCGTGCATAGGCTAGGCTAA
>probe:Drosophila_2:1638822_at:167:231; Interrogation_Position=986; Antisense; AATGAGCAAGTATCTGCTGCCCAGC

Paste this into a BLAST search page for me
GCCGCTGCTGCAAAAGATGGTCAACTGGTCAACGAGACGCTGGATCTGTTGTGTGCTCGCACAATGTAAGCCGTGAAGCCGTGGTTTTGTGCTGGCCTGCATGGGCGAAACTTTGCAGCATCTGCAACTTGCTGAACATCAACCGAGTGCAACCGAGTGCTGTTGGCGTTGGCAAGTTGGCAAAGCTCATTCCTATCATCTATCATCAGTGGTCTCACCTCGAGAAGAGGCTTCGATACCACTTCGCGACTAACCTTCTACGTGGTCGCCGAGAAGAAAGCTTTAGCTCCGCTTAGAGGATGCATCCGTGCATAGGCTAGGCTAAAATGAGCAAGTATCTGCTGCCCAGC

Full Affymetrix probeset data:

Annotations for 1638822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720