FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638823_at:

>probe:Drosophila_2:1638823_at:405:169; Interrogation_Position=1004; Antisense; AAATGGAGTCCTTCTGGCGACGCGT
>probe:Drosophila_2:1638823_at:193:411; Interrogation_Position=1022; Antisense; GACGCGTCAACAACGTGGCCGTGGA
>probe:Drosophila_2:1638823_at:3:141; Interrogation_Position=1046; Antisense; ACGTGGCCTGCCTGAAGCAACAGAA
>probe:Drosophila_2:1638823_at:410:135; Interrogation_Position=1105; Antisense; ACGCAGCTGCAGGACTACCTGGTAA
>probe:Drosophila_2:1638823_at:592:25; Interrogation_Position=1154; Antisense; ATAGCCACGTCCATAGCTATCTAGC
>probe:Drosophila_2:1638823_at:335:577; Interrogation_Position=1184; Antisense; GGCCCAAGAGCATGTCCGTGGACAG
>probe:Drosophila_2:1638823_at:81:641; Interrogation_Position=1343; Antisense; TCTCCAACGTGGTTCTTTCGAGGAC
>probe:Drosophila_2:1638823_at:341:471; Interrogation_Position=1354; Antisense; GTTCTTTCGAGGACTTTGGCTAGGG
>probe:Drosophila_2:1638823_at:446:83; Interrogation_Position=818; Antisense; AGGGCGAGACTCTGGCACAGTTGTC
>probe:Drosophila_2:1638823_at:448:95; Interrogation_Position=836; Antisense; AGTTGTCTGCGGTCTGTGCCAAGAT
>probe:Drosophila_2:1638823_at:464:289; Interrogation_Position=877; Antisense; CGGATGTTCCAGTTGCCGGAAATAT
>probe:Drosophila_2:1638823_at:119:527; Interrogation_Position=940; Antisense; GGTAATGGTTCCTTGACTGACCCAG
>probe:Drosophila_2:1638823_at:65:309; Interrogation_Position=961; Antisense; CCAGCCACTGATCTTCTTAAGGACG
>probe:Drosophila_2:1638823_at:574:135; Interrogation_Position=983; Antisense; ACGAGGTGGCAGTGGTACCCCAAAT

Paste this into a BLAST search page for me
AAATGGAGTCCTTCTGGCGACGCGTGACGCGTCAACAACGTGGCCGTGGAACGTGGCCTGCCTGAAGCAACAGAAACGCAGCTGCAGGACTACCTGGTAAATAGCCACGTCCATAGCTATCTAGCGGCCCAAGAGCATGTCCGTGGACAGTCTCCAACGTGGTTCTTTCGAGGACGTTCTTTCGAGGACTTTGGCTAGGGAGGGCGAGACTCTGGCACAGTTGTCAGTTGTCTGCGGTCTGTGCCAAGATCGGATGTTCCAGTTGCCGGAAATATGGTAATGGTTCCTTGACTGACCCAGCCAGCCACTGATCTTCTTAAGGACGACGAGGTGGCAGTGGTACCCCAAAT

Full Affymetrix probeset data:

Annotations for 1638823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720