FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638825_at:

>probe:Drosophila_2:1638825_at:707:711; Interrogation_Position=154; Antisense; TTCTTCCGACCCTGGATGGATGAGT
>probe:Drosophila_2:1638825_at:356:203; Interrogation_Position=194; Antisense; AACCACAGCCGCCACGTAAGATTGT
>probe:Drosophila_2:1638825_at:543:215; Interrogation_Position=211; Antisense; AAGATTGTGGCTACATCGACACCGC
>probe:Drosophila_2:1638825_at:596:221; Interrogation_Position=245; Antisense; AAGTGGATGGCACCTACCACGCTAA
>probe:Drosophila_2:1638825_at:596:673; Interrogation_Position=259; Antisense; TACCACGCTAACATGGTGCGCAATC
>probe:Drosophila_2:1638825_at:365:501; Interrogation_Position=323; Antisense; GTCGGGATCGCAACACCTTGGCCAG
>probe:Drosophila_2:1638825_at:402:395; Interrogation_Position=33; Antisense; GAAATTCACTGGAGCTCTGAAGCGA
>probe:Drosophila_2:1638825_at:408:185; Interrogation_Position=395; Antisense; AACAATACCTGACCAGTCGCATTCA
>probe:Drosophila_2:1638825_at:681:501; Interrogation_Position=410; Antisense; GTCGCATTCAGCACGAGGCCAATCT
>probe:Drosophila_2:1638825_at:706:607; Interrogation_Position=452; Antisense; TGAGTCTCTACTATGTGCGCTTCCT
>probe:Drosophila_2:1638825_at:133:227; Interrogation_Position=522; Antisense; AAGGCACATGATGCCGCGCCAACAG
>probe:Drosophila_2:1638825_at:512:323; Interrogation_Position=60; Antisense; GCGCAGCATGGATGCGGACTCTGAT
>probe:Drosophila_2:1638825_at:76:405; Interrogation_Position=76; Antisense; GACTCTGATGACGATGTGGTCTTCA
>probe:Drosophila_2:1638825_at:529:479; Interrogation_Position=94; Antisense; GTCTTCATTATGGAACAGCCGGGCC

Paste this into a BLAST search page for me
TTCTTCCGACCCTGGATGGATGAGTAACCACAGCCGCCACGTAAGATTGTAAGATTGTGGCTACATCGACACCGCAAGTGGATGGCACCTACCACGCTAATACCACGCTAACATGGTGCGCAATCGTCGGGATCGCAACACCTTGGCCAGGAAATTCACTGGAGCTCTGAAGCGAAACAATACCTGACCAGTCGCATTCAGTCGCATTCAGCACGAGGCCAATCTTGAGTCTCTACTATGTGCGCTTCCTAAGGCACATGATGCCGCGCCAACAGGCGCAGCATGGATGCGGACTCTGATGACTCTGATGACGATGTGGTCTTCAGTCTTCATTATGGAACAGCCGGGCC

Full Affymetrix probeset data:

Annotations for 1638825_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720