FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638827_at:

>probe:Drosophila_2:1638827_at:77:173; Interrogation_Position=342; Antisense; AAAGAGGTGCAGTTTGTCCGGCGAT
>probe:Drosophila_2:1638827_at:414:441; Interrogation_Position=364; Antisense; GATGGATGCCGCAACACCAGGCGAT
>probe:Drosophila_2:1638827_at:229:461; Interrogation_Position=386; Antisense; GATTCAAGCACGTGGGCCAGCTGAC
>probe:Drosophila_2:1638827_at:456:609; Interrogation_Position=407; Antisense; TGACGGGCCACGTAATCTTCAGTGC
>probe:Drosophila_2:1638827_at:597:621; Interrogation_Position=455; Antisense; TGCTGCGCCACAAGATCTCGAATTG
>probe:Drosophila_2:1638827_at:620:113; Interrogation_Position=541; Antisense; AGCAGCTTCCGGCAGTTGATACAGG
>probe:Drosophila_2:1638827_at:179:567; Interrogation_Position=620; Antisense; GGCACCAGCAGTTCATCGTCTGTAA
>probe:Drosophila_2:1638827_at:413:637; Interrogation_Position=635; Antisense; TCGTCTGTAACTTTGCCCGTAGGAA
>probe:Drosophila_2:1638827_at:120:527; Interrogation_Position=714; Antisense; GGGAAGGAATCCTCGCTATCCCAAT
>probe:Drosophila_2:1638827_at:635:241; Interrogation_Position=758; Antisense; AATACGATGTGAACGCCGTCGACCG
>probe:Drosophila_2:1638827_at:634:475; Interrogation_Position=782; Antisense; GTTTTCACTCAAAGCGGCCACTTAG
>probe:Drosophila_2:1638827_at:491:223; Interrogation_Position=810; Antisense; AAGGTTCAAGTACAGCGCATCCCAT
>probe:Drosophila_2:1638827_at:407:295; Interrogation_Position=825; Antisense; CGCATCCCATCCATCGAAAGTTTTG
>probe:Drosophila_2:1638827_at:696:507; Interrogation_Position=851; Antisense; GTGCTGATCGTGATGTAGCCTTCCA

Paste this into a BLAST search page for me
AAAGAGGTGCAGTTTGTCCGGCGATGATGGATGCCGCAACACCAGGCGATGATTCAAGCACGTGGGCCAGCTGACTGACGGGCCACGTAATCTTCAGTGCTGCTGCGCCACAAGATCTCGAATTGAGCAGCTTCCGGCAGTTGATACAGGGGCACCAGCAGTTCATCGTCTGTAATCGTCTGTAACTTTGCCCGTAGGAAGGGAAGGAATCCTCGCTATCCCAATAATACGATGTGAACGCCGTCGACCGGTTTTCACTCAAAGCGGCCACTTAGAAGGTTCAAGTACAGCGCATCCCATCGCATCCCATCCATCGAAAGTTTTGGTGCTGATCGTGATGTAGCCTTCCA

Full Affymetrix probeset data:

Annotations for 1638827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720