FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638830_at:

>probe:Drosophila_2:1638830_at:74:395; Interrogation_Position=1046; Antisense; GAAATCCTTGCTATGACAAACCTGG
>probe:Drosophila_2:1638830_at:80:69; Interrogation_Position=1139; Antisense; ATGGCCGATCAGTTTATACGTGAAC
>probe:Drosophila_2:1638830_at:433:257; Interrogation_Position=1163; Antisense; CACATCGAAGATTTGCTGCGTAACA
>probe:Drosophila_2:1638830_at:340:355; Interrogation_Position=1191; Antisense; GCACCCAGGTGCTTATAAAACTTAT
>probe:Drosophila_2:1638830_at:598:685; Interrogation_Position=1213; Antisense; TATCAGGCCCTATAAGAACATCGCT
>probe:Drosophila_2:1638830_at:587:211; Interrogation_Position=1226; Antisense; AAGAACATCGCTATACCCTTCATAG
>probe:Drosophila_2:1638830_at:543:331; Interrogation_Position=1291; Antisense; GCTGGTTTCCTGCATTCTAGATGAC
>probe:Drosophila_2:1638830_at:240:223; Interrogation_Position=1322; Antisense; AAGGGACGCATCGACCAGGTGAATC
>probe:Drosophila_2:1638830_at:543:95; Interrogation_Position=1365; Antisense; AGATCAACAGCAGTGCTTCGCGGTA
>probe:Drosophila_2:1638830_at:292:275; Interrogation_Position=1380; Antisense; CTTCGCGGTACAATGCCCTGGAAAA
>probe:Drosophila_2:1638830_at:303:165; Interrogation_Position=1416; Antisense; AAATCCAATCGCTGCAGTTCGCTGT
>probe:Drosophila_2:1638830_at:414:89; Interrogation_Position=1459; Antisense; AGTACAGCTACATATTTCCAATTCG
>probe:Drosophila_2:1638830_at:486:323; Interrogation_Position=940; Antisense; GCGCAGAACCACTTGCCTAAAGTAC
>probe:Drosophila_2:1638830_at:329:525; Interrogation_Position=994; Antisense; GGGCATAAATCCCTTTGACTCACAG

Paste this into a BLAST search page for me
GAAATCCTTGCTATGACAAACCTGGATGGCCGATCAGTTTATACGTGAACCACATCGAAGATTTGCTGCGTAACAGCACCCAGGTGCTTATAAAACTTATTATCAGGCCCTATAAGAACATCGCTAAGAACATCGCTATACCCTTCATAGGCTGGTTTCCTGCATTCTAGATGACAAGGGACGCATCGACCAGGTGAATCAGATCAACAGCAGTGCTTCGCGGTACTTCGCGGTACAATGCCCTGGAAAAAAATCCAATCGCTGCAGTTCGCTGTAGTACAGCTACATATTTCCAATTCGGCGCAGAACCACTTGCCTAAAGTACGGGCATAAATCCCTTTGACTCACAG

Full Affymetrix probeset data:

Annotations for 1638830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720