FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638832_at:

>probe:Drosophila_2:1638832_at:231:377; Interrogation_Position=139; Antisense; GAAGCATGTGAACCACCGTCGCGAC
>probe:Drosophila_2:1638832_at:295:211; Interrogation_Position=188; Antisense; AAGAAGGCTCATTTGGGCACCAGAT
>probe:Drosophila_2:1638832_at:265:225; Interrogation_Position=215; Antisense; AAGGCTAATCCCTTCGGAGGTGCTT
>probe:Drosophila_2:1638832_at:604:185; Interrogation_Position=253; Antisense; AATCGTCCTGGAGAAGGTCGGCGTC
>probe:Drosophila_2:1638832_at:589:85; Interrogation_Position=309; Antisense; AGTGCGTGAGGGTGCAGCTCATCAA
>probe:Drosophila_2:1638832_at:119:625; Interrogation_Position=360; Antisense; TGCCCCGTGACGGTAGCTTGAACTA
>probe:Drosophila_2:1638832_at:163:307; Interrogation_Position=412; Antisense; TGCCGGTTTCGGTCGTAAGGGTCAT
>probe:Drosophila_2:1638832_at:193:81; Interrogation_Position=429; Antisense; AGGGTCATGCCGTCGGTGATATTCC
>probe:Drosophila_2:1638832_at:52:605; Interrogation_Position=445; Antisense; TGATATTCCCGGTGTGCGCTTCAAG
>probe:Drosophila_2:1638832_at:23:343; Interrogation_Position=462; Antisense; GCTTCAAGGTTGTCAAGGTCGCCAA
>probe:Drosophila_2:1638832_at:539:305; Interrogation_Position=493; Antisense; CCTGTTGGCCCTCTACAAGGAGAAG
>probe:Drosophila_2:1638832_at:558:371; Interrogation_Position=517; Antisense; GAAGGAACGCCCAAGATCTTAGATG
>probe:Drosophila_2:1638832_at:564:385; Interrogation_Position=541; Antisense; GAACATGCATCTAATCTTTTTCCAG
>probe:Drosophila_2:1638832_at:338:727; Interrogation_Position=660; Antisense; TTGTGGCTCGCATGTTTGTGTTTAC

Paste this into a BLAST search page for me
GAAGCATGTGAACCACCGTCGCGACAAGAAGGCTCATTTGGGCACCAGATAAGGCTAATCCCTTCGGAGGTGCTTAATCGTCCTGGAGAAGGTCGGCGTCAGTGCGTGAGGGTGCAGCTCATCAATGCCCCGTGACGGTAGCTTGAACTATGCCGGTTTCGGTCGTAAGGGTCATAGGGTCATGCCGTCGGTGATATTCCTGATATTCCCGGTGTGCGCTTCAAGGCTTCAAGGTTGTCAAGGTCGCCAACCTGTTGGCCCTCTACAAGGAGAAGGAAGGAACGCCCAAGATCTTAGATGGAACATGCATCTAATCTTTTTCCAGTTGTGGCTCGCATGTTTGTGTTTAC

Full Affymetrix probeset data:

Annotations for 1638832_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720