FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638833_at:

>probe:Drosophila_2:1638833_at:17:633; Interrogation_Position=2236; Antisense; TCGTCTCGGTGGCTGGTAACCATTG
>probe:Drosophila_2:1638833_at:381:687; Interrogation_Position=2308; Antisense; TATTCCCCTCGTTCAAGGTGGAGGA
>probe:Drosophila_2:1638833_at:67:331; Interrogation_Position=2364; Antisense; GCGGGCATTTAGTTAGTTGCTCACA
>probe:Drosophila_2:1638833_at:519:151; Interrogation_Position=2386; Antisense; ACATCACTACATTCTCGGCCATGTT
>probe:Drosophila_2:1638833_at:516:287; Interrogation_Position=2401; Antisense; CGGCCATGTTGTTGATCGATCTGTA
>probe:Drosophila_2:1638833_at:546:451; Interrogation_Position=2418; Antisense; GATCTGTAAATCCTATCTGCCGCAT
>probe:Drosophila_2:1638833_at:455:565; Interrogation_Position=2450; Antisense; GGAATTTCCATGGTGCATATCGATT
>probe:Drosophila_2:1638833_at:74:23; Interrogation_Position=2466; Antisense; ATATCGATTCGGCTCGGATCAGCAT
>probe:Drosophila_2:1638833_at:241:651; Interrogation_Position=2490; Antisense; TCACCAGAATCTATCGAATGTCCAG
>probe:Drosophila_2:1638833_at:89:233; Interrogation_Position=2522; Antisense; AATGAAATCTCGCTCTTTCTGTACT
>probe:Drosophila_2:1638833_at:694:337; Interrogation_Position=2533; Antisense; GCTCTTTCTGTACTTGTCCATCAAT
>probe:Drosophila_2:1638833_at:60:149; Interrogation_Position=2563; Antisense; ACTATTTCTTCATGTTCTCGTCTGC
>probe:Drosophila_2:1638833_at:537:697; Interrogation_Position=2593; Antisense; TTTACGCTCTGATTTCGATTCCGAA
>probe:Drosophila_2:1638833_at:172:509; Interrogation_Position=2746; Antisense; GTGCATGTAGTTTCACTAAGCGCAA

Paste this into a BLAST search page for me
TCGTCTCGGTGGCTGGTAACCATTGTATTCCCCTCGTTCAAGGTGGAGGAGCGGGCATTTAGTTAGTTGCTCACAACATCACTACATTCTCGGCCATGTTCGGCCATGTTGTTGATCGATCTGTAGATCTGTAAATCCTATCTGCCGCATGGAATTTCCATGGTGCATATCGATTATATCGATTCGGCTCGGATCAGCATTCACCAGAATCTATCGAATGTCCAGAATGAAATCTCGCTCTTTCTGTACTGCTCTTTCTGTACTTGTCCATCAATACTATTTCTTCATGTTCTCGTCTGCTTTACGCTCTGATTTCGATTCCGAAGTGCATGTAGTTTCACTAAGCGCAA

Full Affymetrix probeset data:

Annotations for 1638833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720