Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638834_a_at:

>probe:Drosophila_2:1638834_a_at:504:283; Interrogation_Position=278; Antisense; CGGAGCCGTTTCACGATCTGGAAGT
>probe:Drosophila_2:1638834_a_at:487:221; Interrogation_Position=299; Antisense; AAGTGTGTATGAGCCTTCGCCAGCC
>probe:Drosophila_2:1638834_a_at:500:97; Interrogation_Position=386; Antisense; AGATGCGCTACCTAGGAAACCCCGA
>probe:Drosophila_2:1638834_a_at:385:579; Interrogation_Position=425; Antisense; GGCCTACATTGGTACGCAGCTGCAT
>probe:Drosophila_2:1638834_a_at:27:719; Interrogation_Position=499; Antisense; TTCCGCCTGGAGTTCGAGTACATAG
>probe:Drosophila_2:1638834_a_at:353:257; Interrogation_Position=524; Antisense; CAAAGGGCTATATGTTCCGCAAGGG
>probe:Drosophila_2:1638834_a_at:289:577; Interrogation_Position=548; Antisense; GGCGCATGAAGATTACCGTCTCCAA
>probe:Drosophila_2:1638834_a_at:603:207; Interrogation_Position=571; Antisense; AAGCTCATTAAGATTGTGCCCGGCA
>probe:Drosophila_2:1638834_a_at:384:25; Interrogation_Position=637; Antisense; ATAGTGGAACTCTCTGTGGTGGCGC
>probe:Drosophila_2:1638834_a_at:352:395; Interrogation_Position=688; Antisense; GAAATGCGCGTGTTTGCCGAGCAAC
>probe:Drosophila_2:1638834_a_at:542:663; Interrogation_Position=713; Antisense; TAAAGCCACTCGTGCAGCTCGAGAA
>probe:Drosophila_2:1638834_a_at:445:635; Interrogation_Position=740; Antisense; TCGACTACAAGCGACTGGGCGGCAT
>probe:Drosophila_2:1638834_a_at:46:575; Interrogation_Position=757; Antisense; GGCGGCATGCCGTAGTTTACAATAA
>probe:Drosophila_2:1638834_a_at:179:617; Interrogation_Position=785; Antisense; TGCACATCGCATTTATCCAACAGTT

Paste this into a BLAST search page for me
CGGAGCCGTTTCACGATCTGGAAGTAAGTGTGTATGAGCCTTCGCCAGCCAGATGCGCTACCTAGGAAACCCCGAGGCCTACATTGGTACGCAGCTGCATTTCCGCCTGGAGTTCGAGTACATAGCAAAGGGCTATATGTTCCGCAAGGGGGCGCATGAAGATTACCGTCTCCAAAAGCTCATTAAGATTGTGCCCGGCAATAGTGGAACTCTCTGTGGTGGCGCGAAATGCGCGTGTTTGCCGAGCAACTAAAGCCACTCGTGCAGCTCGAGAATCGACTACAAGCGACTGGGCGGCATGGCGGCATGCCGTAGTTTACAATAATGCACATCGCATTTATCCAACAGTT

Full Affymetrix probeset data:

Annotations for 1638834_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime