Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638836_at:

>probe:Drosophila_2:1638836_at:698:85; Interrogation_Position=157; Antisense; AGTGCGGCAGCGAGTGACGTCACAC
>probe:Drosophila_2:1638836_at:179:331; Interrogation_Position=359; Antisense; GCTGGAAACGGATTCGGACAGTTCA
>probe:Drosophila_2:1638836_at:268:555; Interrogation_Position=374; Antisense; GGACAGTTCAGAGGAGTTTTTCGAT
>probe:Drosophila_2:1638836_at:144:637; Interrogation_Position=394; Antisense; TCGATGCCGAGGACACTACGCCCAA
>probe:Drosophila_2:1638836_at:556:311; Interrogation_Position=415; Antisense; CCAATCGCCATTCGACTTTGTGTCG
>probe:Drosophila_2:1638836_at:176:693; Interrogation_Position=431; Antisense; TTTGTGTCGAAAGCTGCCGCCCGAG
>probe:Drosophila_2:1638836_at:87:435; Interrogation_Position=453; Antisense; GAGGTGGCCCAGGAGTTCATCTTTC
>probe:Drosophila_2:1638836_at:363:123; Interrogation_Position=481; Antisense; AGCCCGCCGTGAGAGTGAATGCCGC
>probe:Drosophila_2:1638836_at:115:447; Interrogation_Position=522; Antisense; GATGCTACGCCCATTGGCGCTGGAA
>probe:Drosophila_2:1638836_at:83:653; Interrogation_Position=569; Antisense; TAATAGCCTGGGTGCCCGGCTAAAG
>probe:Drosophila_2:1638836_at:375:293; Interrogation_Position=614; Antisense; CGTTGAGCCCAAGCCCGTGATAGGA
>probe:Drosophila_2:1638836_at:633:405; Interrogation_Position=637; Antisense; GACCTTTGGGTAGACAGCGCTTTCA
>probe:Drosophila_2:1638836_at:157:123; Interrogation_Position=652; Antisense; AGCGCTTTCACGAACTACGTCAGTG
>probe:Drosophila_2:1638836_at:651:559; Interrogation_Position=705; Antisense; GGAAATACACTCACACCTGATTCTC

Paste this into a BLAST search page for me
AGTGCGGCAGCGAGTGACGTCACACGCTGGAAACGGATTCGGACAGTTCAGGACAGTTCAGAGGAGTTTTTCGATTCGATGCCGAGGACACTACGCCCAACCAATCGCCATTCGACTTTGTGTCGTTTGTGTCGAAAGCTGCCGCCCGAGGAGGTGGCCCAGGAGTTCATCTTTCAGCCCGCCGTGAGAGTGAATGCCGCGATGCTACGCCCATTGGCGCTGGAATAATAGCCTGGGTGCCCGGCTAAAGCGTTGAGCCCAAGCCCGTGATAGGAGACCTTTGGGTAGACAGCGCTTTCAAGCGCTTTCACGAACTACGTCAGTGGGAAATACACTCACACCTGATTCTC

Full Affymetrix probeset data:

Annotations for 1638836_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime