FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638838_at:

>probe:Drosophila_2:1638838_at:320:285; Interrogation_Position=1009; Antisense; CTGTCGGATGATCGGCTCCATGAAG
>probe:Drosophila_2:1638838_at:78:51; Interrogation_Position=1035; Antisense; ATGCCGCCGAGTTCGTGTATAACAT
>probe:Drosophila_2:1638838_at:268:637; Interrogation_Position=1047; Antisense; TCGTGTATAACATCTCCTTGGAGGC
>probe:Drosophila_2:1638838_at:171:273; Interrogation_Position=1063; Antisense; CTTGGAGGCCTATAATCGCACTCTC
>probe:Drosophila_2:1638838_at:60:455; Interrogation_Position=1107; Antisense; GATCAATCCGTGAGAACTTCTCCTC
>probe:Drosophila_2:1638838_at:311:241; Interrogation_Position=1160; Antisense; AATAAGCACACCGTCGAACTGTTCT
>probe:Drosophila_2:1638838_at:305:601; Interrogation_Position=1179; Antisense; TGTTCTCTGAGGACGGTAATCTTGC
>probe:Drosophila_2:1638838_at:30:239; Interrogation_Position=1196; Antisense; AATCTTGCCCTGAACGTGGTCATTA
>probe:Drosophila_2:1638838_at:341:549; Interrogation_Position=1227; Antisense; TGGAGGAGCGTACCAACTAACCCCT
>probe:Drosophila_2:1638838_at:556:161; Interrogation_Position=1281; Antisense; AAATTGGACTTTCGTCGCTGATTGG
>probe:Drosophila_2:1638838_at:8:403; Interrogation_Position=869; Antisense; GACATCATCTTTTTGGCCACCAATG
>probe:Drosophila_2:1638838_at:19:251; Interrogation_Position=889; Antisense; CAATGTGAATCTGGAGGGTGCCCTC
>probe:Drosophila_2:1638838_at:656:625; Interrogation_Position=907; Antisense; TGCCCTCGACTGGACAATGGTGCAG
>probe:Drosophila_2:1638838_at:280:437; Interrogation_Position=983; Antisense; GAGGACTGTCAGCAGTACTTCACCG

Paste this into a BLAST search page for me
CTGTCGGATGATCGGCTCCATGAAGATGCCGCCGAGTTCGTGTATAACATTCGTGTATAACATCTCCTTGGAGGCCTTGGAGGCCTATAATCGCACTCTCGATCAATCCGTGAGAACTTCTCCTCAATAAGCACACCGTCGAACTGTTCTTGTTCTCTGAGGACGGTAATCTTGCAATCTTGCCCTGAACGTGGTCATTATGGAGGAGCGTACCAACTAACCCCTAAATTGGACTTTCGTCGCTGATTGGGACATCATCTTTTTGGCCACCAATGCAATGTGAATCTGGAGGGTGCCCTCTGCCCTCGACTGGACAATGGTGCAGGAGGACTGTCAGCAGTACTTCACCG

Full Affymetrix probeset data:

Annotations for 1638838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720