FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638839_at:

>probe:Drosophila_2:1638839_at:643:311; Interrogation_Position=3829; Antisense; GCCAAAGCTCTTTAGCCACGGATAT
>probe:Drosophila_2:1638839_at:573:543; Interrogation_Position=3848; Antisense; GGATATCGACATGCCACTGATTGGA
>probe:Drosophila_2:1638839_at:69:551; Interrogation_Position=3870; Antisense; GGAGAGCTCTCTGAGCCAAATGCTC
>probe:Drosophila_2:1638839_at:635:133; Interrogation_Position=3927; Antisense; ACGCCCATGTTCGATGCAGTCGCTG
>probe:Drosophila_2:1638839_at:218:297; Interrogation_Position=3994; Antisense; CGCAATGATACAAGCCCCACGGAAA
>probe:Drosophila_2:1638839_at:459:559; Interrogation_Position=4014; Antisense; GGAAAGCTCAAATCACGCGACTATA
>probe:Drosophila_2:1638839_at:269:147; Interrogation_Position=4033; Antisense; ACTATACCCTTCACTGGCAGAACTA
>probe:Drosophila_2:1638839_at:728:171; Interrogation_Position=4064; Antisense; AAAGTTCATTCATATTCATCGCACA
>probe:Drosophila_2:1638839_at:697:689; Interrogation_Position=4076; Antisense; TATTCATCGCACATTGGCCATATCC
>probe:Drosophila_2:1638839_at:626:21; Interrogation_Position=4095; Antisense; ATATCCCGAATTCCGTATCACCAAT
>probe:Drosophila_2:1638839_at:23:53; Interrogation_Position=4152; Antisense; ATGAATTGTATATTGGCCCCTTTTA
>probe:Drosophila_2:1638839_at:672:231; Interrogation_Position=4196; Antisense; AATGAAATCTCAGTTGCACAAGGGA
>probe:Drosophila_2:1638839_at:460:575; Interrogation_Position=4269; Antisense; GGCGTAATCAATCCTCTGCAATGGG
>probe:Drosophila_2:1638839_at:113:359; Interrogation_Position=4286; Antisense; GCAATGGGATCTTTATCTTTACATC

Paste this into a BLAST search page for me
GCCAAAGCTCTTTAGCCACGGATATGGATATCGACATGCCACTGATTGGAGGAGAGCTCTCTGAGCCAAATGCTCACGCCCATGTTCGATGCAGTCGCTGCGCAATGATACAAGCCCCACGGAAAGGAAAGCTCAAATCACGCGACTATAACTATACCCTTCACTGGCAGAACTAAAAGTTCATTCATATTCATCGCACATATTCATCGCACATTGGCCATATCCATATCCCGAATTCCGTATCACCAATATGAATTGTATATTGGCCCCTTTTAAATGAAATCTCAGTTGCACAAGGGAGGCGTAATCAATCCTCTGCAATGGGGCAATGGGATCTTTATCTTTACATC

Full Affymetrix probeset data:

Annotations for 1638839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720