FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638840_at:

>probe:Drosophila_2:1638840_at:586:709; Interrogation_Position=1024; Antisense; TTAAGTGGGCTCACTCTCAGGCAAA
>probe:Drosophila_2:1638840_at:374:267; Interrogation_Position=1050; Antisense; CAGGGCACCGCTGCAAAGACAGACA
>probe:Drosophila_2:1638840_at:368:183; Interrogation_Position=1065; Antisense; AAGACAGACAGACGCTTCGACTTGG
>probe:Drosophila_2:1638840_at:437:253; Interrogation_Position=1121; Antisense; CGACTACTTCAATCTTCGCCAAGAG
>probe:Drosophila_2:1638840_at:489:421; Interrogation_Position=1143; Antisense; GAGCAAATCAATGTCATGCCCGCCG
>probe:Drosophila_2:1638840_at:6:379; Interrogation_Position=1172; Antisense; GAAGCTGCATCAGTTGCCATCAAAT
>probe:Drosophila_2:1638840_at:664:33; Interrogation_Position=1190; Antisense; ATCAAATCTAGTTCCGGCGTCGGCT
>probe:Drosophila_2:1638840_at:80:289; Interrogation_Position=1204; Antisense; CGGCGTCGGCTTACCAAATGTATGG
>probe:Drosophila_2:1638840_at:530:681; Interrogation_Position=1224; Antisense; TATGGTCAGCCTACTTATGCAGCTC
>probe:Drosophila_2:1638840_at:305:697; Interrogation_Position=1276; Antisense; TTTCTTCCTCGGGTGTCAATTTGGA
>probe:Drosophila_2:1638840_at:403:691; Interrogation_Position=1295; Antisense; TTTGGATTCCATATCGATTCCTCCG
>probe:Drosophila_2:1638840_at:243:293; Interrogation_Position=1325; Antisense; GGGTCAAGTACCGTATCCAAGTCAG
>probe:Drosophila_2:1638840_at:553:673; Interrogation_Position=1338; Antisense; TATCCAAGTCAGGACGCCAGTCGGA
>probe:Drosophila_2:1638840_at:310:133; Interrogation_Position=1387; Antisense; ACCCTGTGGTCTACAATGGTTCCAA

Paste this into a BLAST search page for me
TTAAGTGGGCTCACTCTCAGGCAAACAGGGCACCGCTGCAAAGACAGACAAAGACAGACAGACGCTTCGACTTGGCGACTACTTCAATCTTCGCCAAGAGGAGCAAATCAATGTCATGCCCGCCGGAAGCTGCATCAGTTGCCATCAAATATCAAATCTAGTTCCGGCGTCGGCTCGGCGTCGGCTTACCAAATGTATGGTATGGTCAGCCTACTTATGCAGCTCTTTCTTCCTCGGGTGTCAATTTGGATTTGGATTCCATATCGATTCCTCCGGGGTCAAGTACCGTATCCAAGTCAGTATCCAAGTCAGGACGCCAGTCGGAACCCTGTGGTCTACAATGGTTCCAA

Full Affymetrix probeset data:

Annotations for 1638840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720