Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638841_at:

>probe:Drosophila_2:1638841_at:63:185; Interrogation_Position=1039; Antisense; AACAACACTTTGAGCTTCTTGGCCA
>probe:Drosophila_2:1638841_at:280:237; Interrogation_Position=1066; Antisense; AATCGCAAGTTAGCCAGCATCTGGA
>probe:Drosophila_2:1638841_at:653:575; Interrogation_Position=1102; Antisense; GGCGAAAAGCATCCACTGATCTCTC
>probe:Drosophila_2:1638841_at:583:37; Interrogation_Position=1120; Antisense; ATCTCTCCTGGAGCCGTGGTAAAAT
>probe:Drosophila_2:1638841_at:378:611; Interrogation_Position=1205; Antisense; TGAACTTCAGCGTTTTCGGACCCAA
>probe:Drosophila_2:1638841_at:244:77; Interrogation_Position=1292; Antisense; AGGAGGGCTGCAACATCGACAACTG
>probe:Drosophila_2:1638841_at:702:247; Interrogation_Position=1320; Antisense; AATTGGCCATCGAGCACAGGTGAAG
>probe:Drosophila_2:1638841_at:113:545; Interrogation_Position=1348; Antisense; GGATCCGTCCTGAAGAACTGCATAA
>probe:Drosophila_2:1638841_at:60:77; Interrogation_Position=1394; Antisense; AGGAGGGCACTCACAGCCAGGCAGT
>probe:Drosophila_2:1638841_at:614:85; Interrogation_Position=1416; Antisense; AGTGCATCTGTCCAACGCGGATCAG
>probe:Drosophila_2:1638841_at:160:331; Interrogation_Position=1465; Antisense; GCGGCTAACTTAATGTGGCTTCCTT
>probe:Drosophila_2:1638841_at:280:575; Interrogation_Position=1511; Antisense; GGCGGATTCTTCTAGCAGGACATTA
>probe:Drosophila_2:1638841_at:378:647; Interrogation_Position=975; Antisense; TCATGGCGATATTGTGCGTTGCTAT
>probe:Drosophila_2:1638841_at:20:725; Interrogation_Position=993; Antisense; TTGCTATGGCATTCAGGCGCCCAGA

Paste this into a BLAST search page for me
AACAACACTTTGAGCTTCTTGGCCAAATCGCAAGTTAGCCAGCATCTGGAGGCGAAAAGCATCCACTGATCTCTCATCTCTCCTGGAGCCGTGGTAAAATTGAACTTCAGCGTTTTCGGACCCAAAGGAGGGCTGCAACATCGACAACTGAATTGGCCATCGAGCACAGGTGAAGGGATCCGTCCTGAAGAACTGCATAAAGGAGGGCACTCACAGCCAGGCAGTAGTGCATCTGTCCAACGCGGATCAGGCGGCTAACTTAATGTGGCTTCCTTGGCGGATTCTTCTAGCAGGACATTATCATGGCGATATTGTGCGTTGCTATTTGCTATGGCATTCAGGCGCCCAGA

Full Affymetrix probeset data:

Annotations for 1638841_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime