FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638845_at:

>probe:Drosophila_2:1638845_at:596:591; Interrogation_Position=101; Antisense; TGGTGGGAATCAAGGCCAGCGACAC
>probe:Drosophila_2:1638845_at:482:51; Interrogation_Position=13; Antisense; ATGCGTGCGGTTATACAAAGGGTTA
>probe:Drosophila_2:1638845_at:372:467; Interrogation_Position=136; Antisense; GTTGAGTATCTTGTCCGGAAAATCT
>probe:Drosophila_2:1638845_at:656:385; Interrogation_Position=153; Antisense; GAAAATCTTGGCTCTCCGTTTATTC
>probe:Drosophila_2:1638845_at:207:169; Interrogation_Position=201; Antisense; AAAGTCCGTGAAGGATCTGAACCTA
>probe:Drosophila_2:1638845_at:613:641; Interrogation_Position=216; Antisense; TCTGAACCTAGAACTGCTGTGCGTC
>probe:Drosophila_2:1638845_at:635:595; Interrogation_Position=233; Antisense; TGTGCGTCTCGCAGTTTACACTGTA
>probe:Drosophila_2:1638845_at:579:707; Interrogation_Position=248; Antisense; TTACACTGTATCACCGCCTTAAGGG
>probe:Drosophila_2:1638845_at:570:563; Interrogation_Position=271; Antisense; GGCAACAAACCGGATTTTTTGGCTG
>probe:Drosophila_2:1638845_at:42:547; Interrogation_Position=309; Antisense; GGAGGCGCAGGAGTTGTACAATCAA
>probe:Drosophila_2:1638845_at:262:21; Interrogation_Position=329; Antisense; ATCAATTTTTGGATCGCCTAGGTCA
>probe:Drosophila_2:1638845_at:443:709; Interrogation_Position=35; Antisense; TTAAGGCTGCCAAAGTGACGGTGTT
>probe:Drosophila_2:1638845_at:156:493; Interrogation_Position=350; Antisense; GTCAATCCTACGATAGCACCAAGAT
>probe:Drosophila_2:1638845_at:21:421; Interrogation_Position=406; Antisense; GATGGACCCGTAACCATTAATTTGG

Paste this into a BLAST search page for me
TGGTGGGAATCAAGGCCAGCGACACATGCGTGCGGTTATACAAAGGGTTAGTTGAGTATCTTGTCCGGAAAATCTGAAAATCTTGGCTCTCCGTTTATTCAAAGTCCGTGAAGGATCTGAACCTATCTGAACCTAGAACTGCTGTGCGTCTGTGCGTCTCGCAGTTTACACTGTATTACACTGTATCACCGCCTTAAGGGGGCAACAAACCGGATTTTTTGGCTGGGAGGCGCAGGAGTTGTACAATCAAATCAATTTTTGGATCGCCTAGGTCATTAAGGCTGCCAAAGTGACGGTGTTGTCAATCCTACGATAGCACCAAGATGATGGACCCGTAACCATTAATTTGG

Full Affymetrix probeset data:

Annotations for 1638845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720