FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638846_at:

>probe:Drosophila_2:1638846_at:192:457; Interrogation_Position=409; Antisense; GATACTCAACATGCTGGTGGCCCGC
>probe:Drosophila_2:1638846_at:634:221; Interrogation_Position=434; Antisense; AAGGGCGTGACCTCCACATAAGTGG
>probe:Drosophila_2:1638846_at:179:531; Interrogation_Position=470; Antisense; GGGTCTCCACAGACTACAGCAGTAT
>probe:Drosophila_2:1638846_at:185:659; Interrogation_Position=496; Antisense; TAAGCGGCATTTAAACTATCCCCTC
>probe:Drosophila_2:1638846_at:94:723; Interrogation_Position=548; Antisense; TTGCCTCCTGCAACCTATGCGAATA
>probe:Drosophila_2:1638846_at:522:53; Interrogation_Position=611; Antisense; ATGCATATCGCACACACATGTAGCC
>probe:Drosophila_2:1638846_at:349:487; Interrogation_Position=630; Antisense; GTAGCCAGACGTAAATGTAGCACCT
>probe:Drosophila_2:1638846_at:74:261; Interrogation_Position=650; Antisense; CACCTAGTAATGCTTCTTGTTGAAT
>probe:Drosophila_2:1638846_at:191:469; Interrogation_Position=668; Antisense; GTTGAATTCGATTTCTTTGCCTCTC
>probe:Drosophila_2:1638846_at:287:627; Interrogation_Position=685; Antisense; TGCCTCTCCATCACTTGTTGAACGA
>probe:Drosophila_2:1638846_at:691:365; Interrogation_Position=708; Antisense; GAATCGCCAAGCTCCTAAGTGTAAA
>probe:Drosophila_2:1638846_at:256:29; Interrogation_Position=808; Antisense; ATACGTGCAGACCATTCCAAAACCA
>probe:Drosophila_2:1638846_at:692:113; Interrogation_Position=839; Antisense; AGCAGCAGCCGAACGCAGAGTTGTT
>probe:Drosophila_2:1638846_at:22:375; Interrogation_Position=927; Antisense; GAAGAAGGCGCATCACTTAAGTTTA

Paste this into a BLAST search page for me
GATACTCAACATGCTGGTGGCCCGCAAGGGCGTGACCTCCACATAAGTGGGGGTCTCCACAGACTACAGCAGTATTAAGCGGCATTTAAACTATCCCCTCTTGCCTCCTGCAACCTATGCGAATAATGCATATCGCACACACATGTAGCCGTAGCCAGACGTAAATGTAGCACCTCACCTAGTAATGCTTCTTGTTGAATGTTGAATTCGATTTCTTTGCCTCTCTGCCTCTCCATCACTTGTTGAACGAGAATCGCCAAGCTCCTAAGTGTAAAATACGTGCAGACCATTCCAAAACCAAGCAGCAGCCGAACGCAGAGTTGTTGAAGAAGGCGCATCACTTAAGTTTA

Full Affymetrix probeset data:

Annotations for 1638846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720