FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638848_at:

>probe:Drosophila_2:1638848_at:431:427; Interrogation_Position=2246; Antisense; GAGATACCACTTGACAGCCTTAGCT
>probe:Drosophila_2:1638848_at:477:707; Interrogation_Position=2265; Antisense; TTAGCTCACTGCAAACCTTCGAGGA
>probe:Drosophila_2:1638848_at:537:625; Interrogation_Position=2325; Antisense; TGCCCCGTCGCAATCTGGAAAAAAT
>probe:Drosophila_2:1638848_at:565:419; Interrogation_Position=2373; Antisense; GAGCATCAGACCAAGTAGCGAGCGA
>probe:Drosophila_2:1638848_at:8:23; Interrogation_Position=2397; Antisense; ATATCAATGATGAGCCGCCAAGCCC
>probe:Drosophila_2:1638848_at:284:321; Interrogation_Position=2418; Antisense; GCCCTGAGACGCTGTTATTGCAAGT
>probe:Drosophila_2:1638848_at:262:333; Interrogation_Position=2457; Antisense; GCTGGCTTCTACACGGCTATATGAA
>probe:Drosophila_2:1638848_at:408:55; Interrogation_Position=2505; Antisense; ATGAACTGCGTCAGTTGTTCCCCTG
>probe:Drosophila_2:1638848_at:418:603; Interrogation_Position=2528; Antisense; TGTTCCTTCCGTTGGCTCTTGGAGA
>probe:Drosophila_2:1638848_at:595:279; Interrogation_Position=2543; Antisense; CTCTTGGAGACGTGTGCCAGCACAA
>probe:Drosophila_2:1638848_at:648:117; Interrogation_Position=2586; Antisense; AGCTCTACGAGGAACTGCTCATTGT
>probe:Drosophila_2:1638848_at:649:59; Interrogation_Position=2618; Antisense; ATGTACCATCACAGCATCAGGGACT
>probe:Drosophila_2:1638848_at:12:215; Interrogation_Position=2685; Antisense; AAGAGAAGGACATCCGAACCCTCGC
>probe:Drosophila_2:1638848_at:583:21; Interrogation_Position=2796; Antisense; ATATTCTTCTACGTAGTGCTCTACC

Paste this into a BLAST search page for me
GAGATACCACTTGACAGCCTTAGCTTTAGCTCACTGCAAACCTTCGAGGATGCCCCGTCGCAATCTGGAAAAAATGAGCATCAGACCAAGTAGCGAGCGAATATCAATGATGAGCCGCCAAGCCCGCCCTGAGACGCTGTTATTGCAAGTGCTGGCTTCTACACGGCTATATGAAATGAACTGCGTCAGTTGTTCCCCTGTGTTCCTTCCGTTGGCTCTTGGAGACTCTTGGAGACGTGTGCCAGCACAAAGCTCTACGAGGAACTGCTCATTGTATGTACCATCACAGCATCAGGGACTAAGAGAAGGACATCCGAACCCTCGCATATTCTTCTACGTAGTGCTCTACC

Full Affymetrix probeset data:

Annotations for 1638848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720