FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638851_at:

>probe:Drosophila_2:1638851_at:687:285; Interrogation_Position=430; Antisense; CGGACAAGGAAACACTGGCCATTTT
>probe:Drosophila_2:1638851_at:386:579; Interrogation_Position=446; Antisense; GGCCATTTTGGATCGGGCACGCAAT
>probe:Drosophila_2:1638851_at:639:95; Interrogation_Position=493; Antisense; AGATCGAGGCGAGCGGAGCTTACAA
>probe:Drosophila_2:1638851_at:701:707; Interrogation_Position=512; Antisense; TTACAAGCAGAGCTATTACCGCCCG
>probe:Drosophila_2:1638851_at:526:219; Interrogation_Position=570; Antisense; AAGTCGCAGCTGCAGTTCACCATGG
>probe:Drosophila_2:1638851_at:137:647; Interrogation_Position=602; Antisense; TCATTTGCCCGATCCGGCGATCAAG
>probe:Drosophila_2:1638851_at:471:501; Interrogation_Position=634; Antisense; GTCGTCCTCGCGAAGAGCAACTGGT
>probe:Drosophila_2:1638851_at:625:639; Interrogation_Position=671; Antisense; TCTCATAAACGAGCTTTTGGACCAA
>probe:Drosophila_2:1638851_at:113:729; Interrogation_Position=687; Antisense; TTGGACCAAATCAACGAGCGTGCTG
>probe:Drosophila_2:1638851_at:126:169; Interrogation_Position=724; Antisense; AAATGGAGTCCATGGGCCAGGGTAA
>probe:Drosophila_2:1638851_at:588:95; Interrogation_Position=775; Antisense; AGATTGCCGAACGTCTGCGTCGCAT
>probe:Drosophila_2:1638851_at:711:343; Interrogation_Position=796; Antisense; GCATTCAGGCGCTGGAGTCCAAGAT
>probe:Drosophila_2:1638851_at:438:443; Interrogation_Position=824; Antisense; GATGAAGTCCAATGGCGGCTTCCGT
>probe:Drosophila_2:1638851_at:417:289; Interrogation_Position=839; Antisense; CGGCTTCCGTTTCGTGGACTAAATG

Paste this into a BLAST search page for me
CGGACAAGGAAACACTGGCCATTTTGGCCATTTTGGATCGGGCACGCAATAGATCGAGGCGAGCGGAGCTTACAATTACAAGCAGAGCTATTACCGCCCGAAGTCGCAGCTGCAGTTCACCATGGTCATTTGCCCGATCCGGCGATCAAGGTCGTCCTCGCGAAGAGCAACTGGTTCTCATAAACGAGCTTTTGGACCAATTGGACCAAATCAACGAGCGTGCTGAAATGGAGTCCATGGGCCAGGGTAAAGATTGCCGAACGTCTGCGTCGCATGCATTCAGGCGCTGGAGTCCAAGATGATGAAGTCCAATGGCGGCTTCCGTCGGCTTCCGTTTCGTGGACTAAATG

Full Affymetrix probeset data:

Annotations for 1638851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720