Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638852_at:

>probe:Drosophila_2:1638852_at:490:187; Interrogation_Position=1024; Antisense; AACACCTCACTATGCTCAATTACAA
>probe:Drosophila_2:1638852_at:295:245; Interrogation_Position=1041; Antisense; AATTACAATCGGAATGCACCCACAC
>probe:Drosophila_2:1638852_at:118:157; Interrogation_Position=1088; Antisense; ACACCGATATAGTCTCTGGGCTTTC
>probe:Drosophila_2:1638852_at:398:525; Interrogation_Position=1105; Antisense; GGGCTTTCATATGCGCCCAGCGAAT
>probe:Drosophila_2:1638852_at:129:325; Interrogation_Position=1124; Antisense; GCGAATGCTTCCAATTGTTCTGCTC
>probe:Drosophila_2:1638852_at:345:633; Interrogation_Position=1147; Antisense; TCCCGCCCGATGTTGATTCACATAT
>probe:Drosophila_2:1638852_at:153:207; Interrogation_Position=1212; Antisense; AAGCGTAAGATGTTCCTGTTGCCGG
>probe:Drosophila_2:1638852_at:18:723; Interrogation_Position=1230; Antisense; TTGCCGGCTTACGTGGATCAGATAA
>probe:Drosophila_2:1638852_at:483:17; Interrogation_Position=1260; Antisense; ATATTGCCATGGCTCATTAACCGGG
>probe:Drosophila_2:1638852_at:334:549; Interrogation_Position=875; Antisense; GGAGGACGTTTGCTTTGTTGACTTC
>probe:Drosophila_2:1638852_at:165:603; Interrogation_Position=890; Antisense; TGTTGACTTCCAGCTCCCAAAATAT
>probe:Drosophila_2:1638852_at:673:297; Interrogation_Position=923; Antisense; CGCCCAAGATCTTCTATGCATACTG
>probe:Drosophila_2:1638852_at:697:617; Interrogation_Position=939; Antisense; TGCATACTGATGACCTCACCTAAGT
>probe:Drosophila_2:1638852_at:678:429; Interrogation_Position=999; Antisense; GAGTATTATCACCAGCAGCTAGTCG

Paste this into a BLAST search page for me
AACACCTCACTATGCTCAATTACAAAATTACAATCGGAATGCACCCACACACACCGATATAGTCTCTGGGCTTTCGGGCTTTCATATGCGCCCAGCGAATGCGAATGCTTCCAATTGTTCTGCTCTCCCGCCCGATGTTGATTCACATATAAGCGTAAGATGTTCCTGTTGCCGGTTGCCGGCTTACGTGGATCAGATAAATATTGCCATGGCTCATTAACCGGGGGAGGACGTTTGCTTTGTTGACTTCTGTTGACTTCCAGCTCCCAAAATATCGCCCAAGATCTTCTATGCATACTGTGCATACTGATGACCTCACCTAAGTGAGTATTATCACCAGCAGCTAGTCG

Full Affymetrix probeset data:

Annotations for 1638852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime