FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638853_at:

>probe:Drosophila_2:1638853_at:40:405; Interrogation_Position=126; Antisense; GACTCCGGGCCAAATCACAAATGAT
>probe:Drosophila_2:1638853_at:465:167; Interrogation_Position=176; Antisense; AAATGCAGGTGCGTGCTGGCAATTT
>probe:Drosophila_2:1638853_at:387:585; Interrogation_Position=192; Antisense; TGGCAATTTCGTTCGCGCAGGAGAA
>probe:Drosophila_2:1638853_at:314:469; Interrogation_Position=202; Antisense; GTTCGCGCAGGAGAAGCTCTAATTA
>probe:Drosophila_2:1638853_at:107:43; Interrogation_Position=21; Antisense; CTCGAAGGACGAGGCCCTGCTAAAA
>probe:Drosophila_2:1638853_at:326:245; Interrogation_Position=222; Antisense; AATTAAGCTAGTCCATGATGTCAAG
>probe:Drosophila_2:1638853_at:330:25; Interrogation_Position=293; Antisense; ATAGACAATCGGAGGCAATGCATGC
>probe:Drosophila_2:1638853_at:487:533; Interrogation_Position=321; Antisense; GGTGACCGAGTATGACCAAACACTT
>probe:Drosophila_2:1638853_at:730:691; Interrogation_Position=363; Antisense; TTTGGAAGAGGAGCTGTCCGAACTG
>probe:Drosophila_2:1638853_at:260:497; Interrogation_Position=378; Antisense; GTCCGAACTGGAGTACGAGTACTAC
>probe:Drosophila_2:1638853_at:311:121; Interrogation_Position=409; Antisense; AGCGGTGGACCTGACTTGGATTCAA
>probe:Drosophila_2:1638853_at:293:543; Interrogation_Position=66; Antisense; GGATAACGTCCTAAGCATGTTGCTC
>probe:Drosophila_2:1638853_at:220:469; Interrogation_Position=84; Antisense; GTTGCTCAACTTTGAGGAGCTCCTT
>probe:Drosophila_2:1638853_at:455:595; Interrogation_Position=96; Antisense; TGAGGAGCTCCTTAAATTAGTTTCC

Paste this into a BLAST search page for me
GACTCCGGGCCAAATCACAAATGATAAATGCAGGTGCGTGCTGGCAATTTTGGCAATTTCGTTCGCGCAGGAGAAGTTCGCGCAGGAGAAGCTCTAATTACTCGAAGGACGAGGCCCTGCTAAAAAATTAAGCTAGTCCATGATGTCAAGATAGACAATCGGAGGCAATGCATGCGGTGACCGAGTATGACCAAACACTTTTTGGAAGAGGAGCTGTCCGAACTGGTCCGAACTGGAGTACGAGTACTACAGCGGTGGACCTGACTTGGATTCAAGGATAACGTCCTAAGCATGTTGCTCGTTGCTCAACTTTGAGGAGCTCCTTTGAGGAGCTCCTTAAATTAGTTTCC

Full Affymetrix probeset data:

Annotations for 1638853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720