FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638856_at:

>probe:Drosophila_2:1638856_at:703:411; Interrogation_Position=444; Antisense; GACCCTGCTCTTGGACAATCCGGAA
>probe:Drosophila_2:1638856_at:22:489; Interrogation_Position=486; Antisense; GTACGACGTAGACGGCAAGCTGCTC
>probe:Drosophila_2:1638856_at:714:647; Interrogation_Position=509; Antisense; TCATCCTGCCCATTGTCAGCAAGGG
>probe:Drosophila_2:1638856_at:677:221; Interrogation_Position=529; Antisense; AAGGGCGACCTGACCATTCGGTTGA
>probe:Drosophila_2:1638856_at:318:11; Interrogation_Position=544; Antisense; ATTCGGTTGAACGATGTGCACACAA
>probe:Drosophila_2:1638856_at:629:221; Interrogation_Position=568; Antisense; AAGGTTTGGATTACCGCCGAGCCAG
>probe:Drosophila_2:1638856_at:287:31; Interrogation_Position=652; Antisense; ATCAAGGGTGGCCACTTTGACCTGT
>probe:Drosophila_2:1638856_at:329:725; Interrogation_Position=668; Antisense; TTGACCTGTCGAATCTGTTCAACGA
>probe:Drosophila_2:1638856_at:721:295; Interrogation_Position=767; Antisense; CGAAGATCAACGAGGCCTGCGCCAA
>probe:Drosophila_2:1638856_at:291:227; Interrogation_Position=790; Antisense; AAGGCCTTCAGTGCCATCGTACAGA
>probe:Drosophila_2:1638856_at:694:665; Interrogation_Position=809; Antisense; TACAGAGTCTGTGGGCCAACATTCC
>probe:Drosophila_2:1638856_at:297:157; Interrogation_Position=877; Antisense; ACAAAGTCCGGTCTAACTAGCCACT
>probe:Drosophila_2:1638856_at:505:617; Interrogation_Position=931; Antisense; TGCAGCTAAATCCAATCCATCTTCG
>probe:Drosophila_2:1638856_at:278:83; Interrogation_Position=974; Antisense; AGTGTTGGCGTTGGCTTTTCGATAT

Paste this into a BLAST search page for me
GACCCTGCTCTTGGACAATCCGGAAGTACGACGTAGACGGCAAGCTGCTCTCATCCTGCCCATTGTCAGCAAGGGAAGGGCGACCTGACCATTCGGTTGAATTCGGTTGAACGATGTGCACACAAAAGGTTTGGATTACCGCCGAGCCAGATCAAGGGTGGCCACTTTGACCTGTTTGACCTGTCGAATCTGTTCAACGACGAAGATCAACGAGGCCTGCGCCAAAAGGCCTTCAGTGCCATCGTACAGATACAGAGTCTGTGGGCCAACATTCCACAAAGTCCGGTCTAACTAGCCACTTGCAGCTAAATCCAATCCATCTTCGAGTGTTGGCGTTGGCTTTTCGATAT

Full Affymetrix probeset data:

Annotations for 1638856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720