FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638857_at:

>probe:Drosophila_2:1638857_at:355:71; Interrogation_Position=1892; Antisense; AGGGACTAGTAACACCCTCTGGACT
>probe:Drosophila_2:1638857_at:564:649; Interrogation_Position=1916; Antisense; TCACCAGTGTTCCAGCTGGCATGGA
>probe:Drosophila_2:1638857_at:653:557; Interrogation_Position=1992; Antisense; GGACAACGAAACTCCTGTTCTGTAT
>probe:Drosophila_2:1638857_at:577:469; Interrogation_Position=2008; Antisense; GTTCTGTATCAAGTGCTGCCTGAGA
>probe:Drosophila_2:1638857_at:602:593; Interrogation_Position=2063; Antisense; TGGGATCAACCCATGTCTACGACGT
>probe:Drosophila_2:1638857_at:724:33; Interrogation_Position=2124; Antisense; ATCAACCACAGATCGCGAGGGCATT
>probe:Drosophila_2:1638857_at:211:83; Interrogation_Position=2141; Antisense; AGGGCATTGTGGAACTGGCTCTCGA
>probe:Drosophila_2:1638857_at:600:583; Interrogation_Position=2156; Antisense; TGGCTCTCGATCCTAGCGAATTGGA
>probe:Drosophila_2:1638857_at:449:397; Interrogation_Position=2185; Antisense; GACAATGACGCAATGGCCCAGCGTT
>probe:Drosophila_2:1638857_at:557:577; Interrogation_Position=2199; Antisense; GGCCCAGCGTTATGAGCAACAAATG
>probe:Drosophila_2:1638857_at:101:451; Interrogation_Position=2254; Antisense; GATCTGTCAGACATGTTGGCCGAAC
>probe:Drosophila_2:1638857_at:573:205; Interrogation_Position=2305; Antisense; AAGCGACAGCAAACGGATCCGGCCA
>probe:Drosophila_2:1638857_at:54:545; Interrogation_Position=2319; Antisense; GGATCCGGCCAAGACCACAAAGAAG
>probe:Drosophila_2:1638857_at:654:191; Interrogation_Position=2383; Antisense; AACTTTTCCATTTGTGCGATTGTCA

Paste this into a BLAST search page for me
AGGGACTAGTAACACCCTCTGGACTTCACCAGTGTTCCAGCTGGCATGGAGGACAACGAAACTCCTGTTCTGTATGTTCTGTATCAAGTGCTGCCTGAGATGGGATCAACCCATGTCTACGACGTATCAACCACAGATCGCGAGGGCATTAGGGCATTGTGGAACTGGCTCTCGATGGCTCTCGATCCTAGCGAATTGGAGACAATGACGCAATGGCCCAGCGTTGGCCCAGCGTTATGAGCAACAAATGGATCTGTCAGACATGTTGGCCGAACAAGCGACAGCAAACGGATCCGGCCAGGATCCGGCCAAGACCACAAAGAAGAACTTTTCCATTTGTGCGATTGTCA

Full Affymetrix probeset data:

Annotations for 1638857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720