Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638858_at:

>probe:Drosophila_2:1638858_at:237:609; Interrogation_Position=1033; Antisense; TGACCATTCCCTTGACTGAATCTGG
>probe:Drosophila_2:1638858_at:725:233; Interrogation_Position=529; Antisense; AATCCATGAGCGCATTTCCCGGAGT
>probe:Drosophila_2:1638858_at:157:279; Interrogation_Position=621; Antisense; CTAGCCGCTGTTTTCCTAGAGGATT
>probe:Drosophila_2:1638858_at:450:435; Interrogation_Position=639; Antisense; GAGGATTACATCAGGCCCTTGACGA
>probe:Drosophila_2:1638858_at:474:437; Interrogation_Position=662; Antisense; GAGGAAGCCGCTTACGGAACACCAA
>probe:Drosophila_2:1638858_at:9:145; Interrogation_Position=687; Antisense; ACTGCTGTTATCATGCGTGTTTGTA
>probe:Drosophila_2:1638858_at:530:247; Interrogation_Position=719; Antisense; AATTGGAGTCATGAGTGTGGCCCTG
>probe:Drosophila_2:1638858_at:641:581; Interrogation_Position=736; Antisense; TGGCCCTGGTTTTTGTTGTGGAGCA
>probe:Drosophila_2:1638858_at:583:441; Interrogation_Position=761; Antisense; GATGGGCTCCCATGTAATGCAGCTT
>probe:Drosophila_2:1638858_at:641:231; Interrogation_Position=776; Antisense; AATGCAGCTTTCCATGACCGTTGGA
>probe:Drosophila_2:1638858_at:137:451; Interrogation_Position=799; Antisense; GATCGGTGGTACAGGGTCCCTTGCT
>probe:Drosophila_2:1638858_at:362:213; Interrogation_Position=867; Antisense; AAGAGCGCCATAGTGGGATCCCTTT
>probe:Drosophila_2:1638858_at:2:507; Interrogation_Position=917; Antisense; GTGCCTATCTGCACAATTGGCCATT
>probe:Drosophila_2:1638858_at:621:681; Interrogation_Position=996; Antisense; TATGAGTTTGATCGCGACCTGGTGA

Paste this into a BLAST search page for me
TGACCATTCCCTTGACTGAATCTGGAATCCATGAGCGCATTTCCCGGAGTCTAGCCGCTGTTTTCCTAGAGGATTGAGGATTACATCAGGCCCTTGACGAGAGGAAGCCGCTTACGGAACACCAAACTGCTGTTATCATGCGTGTTTGTAAATTGGAGTCATGAGTGTGGCCCTGTGGCCCTGGTTTTTGTTGTGGAGCAGATGGGCTCCCATGTAATGCAGCTTAATGCAGCTTTCCATGACCGTTGGAGATCGGTGGTACAGGGTCCCTTGCTAAGAGCGCCATAGTGGGATCCCTTTGTGCCTATCTGCACAATTGGCCATTTATGAGTTTGATCGCGACCTGGTGA

Full Affymetrix probeset data:

Annotations for 1638858_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime