FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638859_at:

>probe:Drosophila_2:1638859_at:227:467; Interrogation_Position=4579; Antisense; GTTGGCTCCTTGACTCAAGCTATGA
>probe:Drosophila_2:1638859_at:636:551; Interrogation_Position=4605; Antisense; GGACCTGACCTTTTGGGTTACCATG
>probe:Drosophila_2:1638859_at:645:591; Interrogation_Position=4649; Antisense; TGGTGGCTCCTGTGTTGGCCTACAA
>probe:Drosophila_2:1638859_at:65:279; Interrogation_Position=4684; Antisense; CTAGATGTACATCCGAGCCTGTCGG
>probe:Drosophila_2:1638859_at:89:375; Interrogation_Position=4734; Antisense; GAAGATCCACTCCAGAGCTTCAAGT
>probe:Drosophila_2:1638859_at:60:541; Interrogation_Position=4810; Antisense; GGTTATGCCTTTGCCCATCAGGAGG
>probe:Drosophila_2:1638859_at:569:75; Interrogation_Position=4829; Antisense; AGGAGGGCTTTGGTCGTCTGATAAC
>probe:Drosophila_2:1638859_at:102:277; Interrogation_Position=4843; Antisense; CGTCTGATAACCTCCGGCAAAATTA
>probe:Drosophila_2:1638859_at:540:245; Interrogation_Position=4863; Antisense; AATTATGCACAAGCTGCCGCAGGAC
>probe:Drosophila_2:1638859_at:429:509; Interrogation_Position=4927; Antisense; GTGCTACACAACAACCTGAACTCGG
>probe:Drosophila_2:1638859_at:324:377; Interrogation_Position=4944; Antisense; GAACTCGGCCGATGGACCAAATTCT
>probe:Drosophila_2:1638859_at:18:359; Interrogation_Position=4973; Antisense; GCAACAATGTGACTGGCCATCATAT
>probe:Drosophila_2:1638859_at:485:173; Interrogation_Position=5037; Antisense; AAACCACTCGTCGATGGCAGACATA
>probe:Drosophila_2:1638859_at:345:99; Interrogation_Position=5115; Antisense; AGATGATATGAGTCCTCGTGCTCCC

Paste this into a BLAST search page for me
GTTGGCTCCTTGACTCAAGCTATGAGGACCTGACCTTTTGGGTTACCATGTGGTGGCTCCTGTGTTGGCCTACAACTAGATGTACATCCGAGCCTGTCGGGAAGATCCACTCCAGAGCTTCAAGTGGTTATGCCTTTGCCCATCAGGAGGAGGAGGGCTTTGGTCGTCTGATAACCGTCTGATAACCTCCGGCAAAATTAAATTATGCACAAGCTGCCGCAGGACGTGCTACACAACAACCTGAACTCGGGAACTCGGCCGATGGACCAAATTCTGCAACAATGTGACTGGCCATCATATAAACCACTCGTCGATGGCAGACATAAGATGATATGAGTCCTCGTGCTCCC

Full Affymetrix probeset data:

Annotations for 1638859_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720