FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638861_at:

>probe:Drosophila_2:1638861_at:509:705; Interrogation_Position=113; Antisense; TTAGCCATTGCTACCAGTACTGATT
>probe:Drosophila_2:1638861_at:616:29; Interrogation_Position=157; Antisense; ATACACTCGTTTGTGATGCGTCGCA
>probe:Drosophila_2:1638861_at:60:341; Interrogation_Position=179; Antisense; GCACTTGGGTCCTGTTTTACTTATT
>probe:Drosophila_2:1638861_at:7:665; Interrogation_Position=196; Antisense; TACTTATTCCTAATTGGGTTGGCAT
>probe:Drosophila_2:1638861_at:326:415; Interrogation_Position=228; Antisense; GACCACACCGAAAGAACTTCACTCA
>probe:Drosophila_2:1638861_at:336:99; Interrogation_Position=267; Antisense; AGATGACGTCGCTCTAAGGTCCAAG
>probe:Drosophila_2:1638861_at:402:491; Interrogation_Position=296; Antisense; GTAAAGCTGATGCTCTGCTTACAAA
>probe:Drosophila_2:1638861_at:256:161; Interrogation_Position=388; Antisense; ACAATCAGGCGCGTTGTAGCCAAGT
>probe:Drosophila_2:1638861_at:347:107; Interrogation_Position=429; Antisense; AGAAAGAACTGACCTCCACCGCAAG
>probe:Drosophila_2:1638861_at:673:367; Interrogation_Position=495; Antisense; GAATCCACATAATCGTGCCGAAGCG
>probe:Drosophila_2:1638861_at:385:389; Interrogation_Position=524; Antisense; GAAACAAGGATCATAGTCCCCATGA
>probe:Drosophila_2:1638861_at:211:439; Interrogation_Position=577; Antisense; GAGGCACTCCCTAAGTCAAATCAGA
>probe:Drosophila_2:1638861_at:358:31; Interrogation_Position=604; Antisense; ATAAATGGCACTACTTCTCTGGAAG
>probe:Drosophila_2:1638861_at:714:461; Interrogation_Position=68; Antisense; GATTCATCATTTCAACAGAGGCTAG

Paste this into a BLAST search page for me
TTAGCCATTGCTACCAGTACTGATTATACACTCGTTTGTGATGCGTCGCAGCACTTGGGTCCTGTTTTACTTATTTACTTATTCCTAATTGGGTTGGCATGACCACACCGAAAGAACTTCACTCAAGATGACGTCGCTCTAAGGTCCAAGGTAAAGCTGATGCTCTGCTTACAAAACAATCAGGCGCGTTGTAGCCAAGTAGAAAGAACTGACCTCCACCGCAAGGAATCCACATAATCGTGCCGAAGCGGAAACAAGGATCATAGTCCCCATGAGAGGCACTCCCTAAGTCAAATCAGAATAAATGGCACTACTTCTCTGGAAGGATTCATCATTTCAACAGAGGCTAG

Full Affymetrix probeset data:

Annotations for 1638861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720