FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638862_at:

>probe:Drosophila_2:1638862_at:312:257; Interrogation_Position=1029; Antisense; CACGGCCATCTATAAGGAATCCCTG
>probe:Drosophila_2:1638862_at:241:435; Interrogation_Position=1067; Antisense; GAGGATTTAATTTCCTCAGCGCCGC
>probe:Drosophila_2:1638862_at:259:141; Interrogation_Position=1097; Antisense; ACGGGCTAGCGTTCATCCTGATTGG
>probe:Drosophila_2:1638862_at:242:631; Interrogation_Position=1112; Antisense; TCCTGATTGGCTGGGTGATGCGAAT
>probe:Drosophila_2:1638862_at:508:215; Interrogation_Position=1153; Antisense; AAGTTCTACGCCAAGACGCTCAAAT
>probe:Drosophila_2:1638862_at:650:587; Interrogation_Position=581; Antisense; TGGAGATCATACTCTTTGTGGCCCT
>probe:Drosophila_2:1638862_at:223:221; Interrogation_Position=609; Antisense; AAGTGGCTCGCTACTATCCAGTTTT
>probe:Drosophila_2:1638862_at:393:683; Interrogation_Position=623; Antisense; TATCCAGTTTTGTTTATGCCGCCAC
>probe:Drosophila_2:1638862_at:143:217; Interrogation_Position=648; Antisense; AAGTTCTGCTCTGGGAATGTCTCCA
>probe:Drosophila_2:1638862_at:397:57; Interrogation_Position=797; Antisense; ATGAGTCGCCAGAAAAGCCTTTAGA
>probe:Drosophila_2:1638862_at:335:233; Interrogation_Position=904; Antisense; AATGCTCACACCATTATTTGGCTAG
>probe:Drosophila_2:1638862_at:518:497; Interrogation_Position=946; Antisense; GTCTCCATTTTTGTTGCCGGTAAGC
>probe:Drosophila_2:1638862_at:243:291; Interrogation_Position=963; Antisense; CGGTAAGCTGTTTGCCATCGGCAAC
>probe:Drosophila_2:1638862_at:548:41; Interrogation_Position=979; Antisense; ATCGGCAACATCCTACAATCGTTCG

Paste this into a BLAST search page for me
CACGGCCATCTATAAGGAATCCCTGGAGGATTTAATTTCCTCAGCGCCGCACGGGCTAGCGTTCATCCTGATTGGTCCTGATTGGCTGGGTGATGCGAATAAGTTCTACGCCAAGACGCTCAAATTGGAGATCATACTCTTTGTGGCCCTAAGTGGCTCGCTACTATCCAGTTTTTATCCAGTTTTGTTTATGCCGCCACAAGTTCTGCTCTGGGAATGTCTCCAATGAGTCGCCAGAAAAGCCTTTAGAAATGCTCACACCATTATTTGGCTAGGTCTCCATTTTTGTTGCCGGTAAGCCGGTAAGCTGTTTGCCATCGGCAACATCGGCAACATCCTACAATCGTTCG

Full Affymetrix probeset data:

Annotations for 1638862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720