Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638864_at:

>probe:Drosophila_2:1638864_at:691:579; Interrogation_Position=1724; Antisense; GGCCACTCAAGCTTTCAAGCCAGAT
>probe:Drosophila_2:1638864_at:437:639; Interrogation_Position=1751; Antisense; TCGGCCAGAGTTGCAGTTCCATAGG
>probe:Drosophila_2:1638864_at:284:469; Interrogation_Position=1766; Antisense; GTTCCATAGGGAGTTTCGAGATCGA
>probe:Drosophila_2:1638864_at:686:449; Interrogation_Position=1785; Antisense; GATCGAGGTGTTCCGAAATCGTTTT
>probe:Drosophila_2:1638864_at:362:41; Interrogation_Position=1802; Antisense; ATCGTTTTTGATTATTGCCTGTGCA
>probe:Drosophila_2:1638864_at:107:667; Interrogation_Position=1887; Antisense; TACACACCGTATATCGCATCGTTTT
>probe:Drosophila_2:1638864_at:636:41; Interrogation_Position=1904; Antisense; ATCGTTTTTATGTGCATTCGCGCCC
>probe:Drosophila_2:1638864_at:268:321; Interrogation_Position=1925; Antisense; GCCCGCACACCCAATTTATATATAA
>probe:Drosophila_2:1638864_at:515:323; Interrogation_Position=1995; Antisense; GCGCGTATATATCTCCATGCTTGTA
>probe:Drosophila_2:1638864_at:194:61; Interrogation_Position=2019; Antisense; ATGTAAGGACGGTGCACGCCATCAA
>probe:Drosophila_2:1638864_at:79:511; Interrogation_Position=2030; Antisense; GTGCACGCCATCAATGTAGCATTCG
>probe:Drosophila_2:1638864_at:91:487; Interrogation_Position=2045; Antisense; GTAGCATTCGCATTTGCATTCGCAT
>probe:Drosophila_2:1638864_at:632:627; Interrogation_Position=2118; Antisense; TCCCGTCTCCTTGTAATTTTATTCT
>probe:Drosophila_2:1638864_at:141:505; Interrogation_Position=2204; Antisense; GTCCACACCAAATGATTTACCGATT

Paste this into a BLAST search page for me
GGCCACTCAAGCTTTCAAGCCAGATTCGGCCAGAGTTGCAGTTCCATAGGGTTCCATAGGGAGTTTCGAGATCGAGATCGAGGTGTTCCGAAATCGTTTTATCGTTTTTGATTATTGCCTGTGCATACACACCGTATATCGCATCGTTTTATCGTTTTTATGTGCATTCGCGCCCGCCCGCACACCCAATTTATATATAAGCGCGTATATATCTCCATGCTTGTAATGTAAGGACGGTGCACGCCATCAAGTGCACGCCATCAATGTAGCATTCGGTAGCATTCGCATTTGCATTCGCATTCCCGTCTCCTTGTAATTTTATTCTGTCCACACCAAATGATTTACCGATT

Full Affymetrix probeset data:

Annotations for 1638864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime