FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638866_at:

>probe:Drosophila_2:1638866_at:396:195; Interrogation_Position=485; Antisense; AACTGGATCTTTGACTACACCGAAA
>probe:Drosophila_2:1638866_at:655:231; Interrogation_Position=508; Antisense; AATGACCAAAGTGTCGTCGCTCACC
>probe:Drosophila_2:1638866_at:543:229; Interrogation_Position=587; Antisense; AATGTGATTACAGCCCAGCGGAGCA
>probe:Drosophila_2:1638866_at:704:441; Interrogation_Position=613; Antisense; GATGGTGTGGGCTTTGATCTTCCTC
>probe:Drosophila_2:1638866_at:538:327; Interrogation_Position=642; Antisense; GCGTTTACGATCTGAGGGAGCTCTC
>probe:Drosophila_2:1638866_at:650:527; Interrogation_Position=657; Antisense; GGGAGCTCTCTAACTTGGAATCGGT
>probe:Drosophila_2:1638866_at:374:565; Interrogation_Position=714; Antisense; GGAATATCGAGTCCGTGTCGCCCAT
>probe:Drosophila_2:1638866_at:512:441; Interrogation_Position=755; Antisense; GATGTTACCGTTTGGAACTCCACCA
>probe:Drosophila_2:1638866_at:219:215; Interrogation_Position=779; Antisense; AAGATCTACGTGGTGGCCGCCGAGC
>probe:Drosophila_2:1638866_at:646:169; Interrogation_Position=828; Antisense; AAAGTCGCCACTACGCTGATGTGCT
>probe:Drosophila_2:1638866_at:55:295; Interrogation_Position=872; Antisense; GCGAGCTTTACGCTCTTCAAAGGGT
>probe:Drosophila_2:1638866_at:262:169; Interrogation_Position=890; Antisense; AAAGGGTACGACCACTTCGACATCA
>probe:Drosophila_2:1638866_at:188:425; Interrogation_Position=920; Antisense; GAGACGGCCATCGACGATTCGGATG
>probe:Drosophila_2:1638866_at:701:177; Interrogation_Position=978; Antisense; AAACTAGGCGCAGTTTCGCTTTGCG

Paste this into a BLAST search page for me
AACTGGATCTTTGACTACACCGAAAAATGACCAAAGTGTCGTCGCTCACCAATGTGATTACAGCCCAGCGGAGCAGATGGTGTGGGCTTTGATCTTCCTCGCGTTTACGATCTGAGGGAGCTCTCGGGAGCTCTCTAACTTGGAATCGGTGGAATATCGAGTCCGTGTCGCCCATGATGTTACCGTTTGGAACTCCACCAAAGATCTACGTGGTGGCCGCCGAGCAAAGTCGCCACTACGCTGATGTGCTGCGAGCTTTACGCTCTTCAAAGGGTAAAGGGTACGACCACTTCGACATCAGAGACGGCCATCGACGATTCGGATGAAACTAGGCGCAGTTTCGCTTTGCG

Full Affymetrix probeset data:

Annotations for 1638866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720