FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638867_at:

>probe:Drosophila_2:1638867_at:323:223; Interrogation_Position=205; Antisense; AAGGGTCACAAGCACGGCGAGCACT
>probe:Drosophila_2:1638867_at:415:377; Interrogation_Position=306; Antisense; GAAGCACAAGCACTCGGAGTCTCAT
>probe:Drosophila_2:1638867_at:114:113; Interrogation_Position=314; Antisense; AGCACTCGGAGTCTCATCACAAGAA
>probe:Drosophila_2:1638867_at:317:353; Interrogation_Position=368; Antisense; GCAGCGAGTTCGAGGATCACGGCTC
>probe:Drosophila_2:1638867_at:154:437; Interrogation_Position=379; Antisense; GAGGATCACGGCTCCTATAAGAAAG
>probe:Drosophila_2:1638867_at:106:559; Interrogation_Position=403; Antisense; GGACACTCCATCAAGGGCAAGCACA
>probe:Drosophila_2:1638867_at:682:565; Interrogation_Position=418; Antisense; GGCAAGCACAACATCCACAAACTAG
>probe:Drosophila_2:1638867_at:184:183; Interrogation_Position=500; Antisense; AAAAGCACGGCGGATTCGAGGAGTC
>probe:Drosophila_2:1638867_at:576:181; Interrogation_Position=536; Antisense; AAAAGGGCAGCAGCTTCAAGAAGGG
>probe:Drosophila_2:1638867_at:237:331; Interrogation_Position=575; Antisense; GCGGCCACGAGGAGAACTACGGCAA
>probe:Drosophila_2:1638867_at:167:147; Interrogation_Position=590; Antisense; ACTACGGCAAGAAGGGTCACAGCAA
>probe:Drosophila_2:1638867_at:441:531; Interrogation_Position=603; Antisense; GGGTCACAGCAAGAAGGGTCACAAA
>probe:Drosophila_2:1638867_at:305:567; Interrogation_Position=731; Antisense; GGCACAAATCGCACAAACAGAGCAG
>probe:Drosophila_2:1638867_at:326:421; Interrogation_Position=750; Antisense; GAGCAGCGAACACGATCATGGACAT

Paste this into a BLAST search page for me
AAGGGTCACAAGCACGGCGAGCACTGAAGCACAAGCACTCGGAGTCTCATAGCACTCGGAGTCTCATCACAAGAAGCAGCGAGTTCGAGGATCACGGCTCGAGGATCACGGCTCCTATAAGAAAGGGACACTCCATCAAGGGCAAGCACAGGCAAGCACAACATCCACAAACTAGAAAAGCACGGCGGATTCGAGGAGTCAAAAGGGCAGCAGCTTCAAGAAGGGGCGGCCACGAGGAGAACTACGGCAAACTACGGCAAGAAGGGTCACAGCAAGGGTCACAGCAAGAAGGGTCACAAAGGCACAAATCGCACAAACAGAGCAGGAGCAGCGAACACGATCATGGACAT

Full Affymetrix probeset data:

Annotations for 1638867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720