FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638868_at:

>probe:Drosophila_2:1638868_at:630:319; Interrogation_Position=2225; Antisense; GCGGAAATCGAACTACTACCGTATT
>probe:Drosophila_2:1638868_at:514:279; Interrogation_Position=2237; Antisense; CTACTACCGTATTCAAGTTGCCCAA
>probe:Drosophila_2:1638868_at:69:253; Interrogation_Position=2250; Antisense; CAAGTTGCCCAAACAGAGCTGTAAG
>probe:Drosophila_2:1638868_at:124:633; Interrogation_Position=2287; Antisense; TCGCGATGGCAAAGGACGGCTATGA
>probe:Drosophila_2:1638868_at:4:391; Interrogation_Position=2341; Antisense; GAAACTCTATCCGTGAGAGGAGACG
>probe:Drosophila_2:1638868_at:126:559; Interrogation_Position=2367; Antisense; GGAAACCTTTATGGGCTGCCTAGCA
>probe:Drosophila_2:1638868_at:159:349; Interrogation_Position=2389; Antisense; GCAGGCAGTGCTAATCTCAACTTGC
>probe:Drosophila_2:1638868_at:234:233; Interrogation_Position=2401; Antisense; AATCTCAACTTGCTGGTACCCGATG
>probe:Drosophila_2:1638868_at:565:487; Interrogation_Position=2416; Antisense; GTACCCGATGAAGAGTGATGCCCCA
>probe:Drosophila_2:1638868_at:547:433; Interrogation_Position=2428; Antisense; GAGTGATGCCCCAATTGGCCGCTAT
>probe:Drosophila_2:1638868_at:649:577; Interrogation_Position=2444; Antisense; GGCCGCTATCTGTTATATTTGGTTT
>probe:Drosophila_2:1638868_at:188:279; Interrogation_Position=2601; Antisense; CTAGAGTGCCTGTGAGATTGTTTAA
>probe:Drosophila_2:1638868_at:544:275; Interrogation_Position=2665; Antisense; CTTATGATTGTTTAGCTTATGGCGT
>probe:Drosophila_2:1638868_at:706:31; Interrogation_Position=2743; Antisense; ATCAACCTAGCTTACTTTAGCAGAG

Paste this into a BLAST search page for me
GCGGAAATCGAACTACTACCGTATTCTACTACCGTATTCAAGTTGCCCAACAAGTTGCCCAAACAGAGCTGTAAGTCGCGATGGCAAAGGACGGCTATGAGAAACTCTATCCGTGAGAGGAGACGGGAAACCTTTATGGGCTGCCTAGCAGCAGGCAGTGCTAATCTCAACTTGCAATCTCAACTTGCTGGTACCCGATGGTACCCGATGAAGAGTGATGCCCCAGAGTGATGCCCCAATTGGCCGCTATGGCCGCTATCTGTTATATTTGGTTTCTAGAGTGCCTGTGAGATTGTTTAACTTATGATTGTTTAGCTTATGGCGTATCAACCTAGCTTACTTTAGCAGAG

Full Affymetrix probeset data:

Annotations for 1638868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720