FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638869_at:

>probe:Drosophila_2:1638869_at:236:389; Interrogation_Position=210; Antisense; GAAAACGCCCAGTACTCGTTCAATT
>probe:Drosophila_2:1638869_at:250:225; Interrogation_Position=289; Antisense; AAGGAGGCACTGTTCGTGGTTCCTA
>probe:Drosophila_2:1638869_at:707:305; Interrogation_Position=310; Antisense; CCTACAGCTACTTCGATGGTTTCGT
>probe:Drosophila_2:1638869_at:50:63; Interrogation_Position=325; Antisense; ATGGTTTCGTGAAGCGCCGTGTTGA
>probe:Drosophila_2:1638869_at:708:317; Interrogation_Position=340; Antisense; GCCGTGTTGAGTACATCGCCGATAA
>probe:Drosophila_2:1638869_at:180:33; Interrogation_Position=361; Antisense; ATAAGGACGGCTACAGGGTGCTCAA
>probe:Drosophila_2:1638869_at:599:61; Interrogation_Position=400; Antisense; ATGTCGGCAATGGTCCTTCGTTCAA
>probe:Drosophila_2:1638869_at:419:293; Interrogation_Position=418; Antisense; CGTTCAATCCCGATGGCATAGCCAA
>probe:Drosophila_2:1638869_at:356:291; Interrogation_Position=443; Antisense; CGTGGAGGGCTCTATGATCGGCAAA
>probe:Drosophila_2:1638869_at:622:451; Interrogation_Position=458; Antisense; GATCGGCAAATACTCCATCAAACTG
>probe:Drosophila_2:1638869_at:549:159; Interrogation_Position=508; Antisense; ACAAGGACATTCATGCCTAGGGCAA
>probe:Drosophila_2:1638869_at:653:389; Interrogation_Position=559; Antisense; GAAACGGACTGAATACTTTGTAGAC
>probe:Drosophila_2:1638869_at:469:221; Interrogation_Position=617; Antisense; AAGTGTATTTCTTCTTCTCCCAAAT
>probe:Drosophila_2:1638869_at:423:159; Interrogation_Position=97; Antisense; ACAAATTCGTGTTGATCGCCAGCCT

Paste this into a BLAST search page for me
GAAAACGCCCAGTACTCGTTCAATTAAGGAGGCACTGTTCGTGGTTCCTACCTACAGCTACTTCGATGGTTTCGTATGGTTTCGTGAAGCGCCGTGTTGAGCCGTGTTGAGTACATCGCCGATAAATAAGGACGGCTACAGGGTGCTCAAATGTCGGCAATGGTCCTTCGTTCAACGTTCAATCCCGATGGCATAGCCAACGTGGAGGGCTCTATGATCGGCAAAGATCGGCAAATACTCCATCAAACTGACAAGGACATTCATGCCTAGGGCAAGAAACGGACTGAATACTTTGTAGACAAGTGTATTTCTTCTTCTCCCAAATACAAATTCGTGTTGATCGCCAGCCT

Full Affymetrix probeset data:

Annotations for 1638869_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720