FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638870_at:

>probe:Drosophila_2:1638870_at:674:259; Interrogation_Position=469; Antisense; CAGCCACATCAATTAGTTCCCTAAA
>probe:Drosophila_2:1638870_at:548:479; Interrogation_Position=495; Antisense; GTTTCCAATCTCAAACGTGGCCGAA
>probe:Drosophila_2:1638870_at:589:125; Interrogation_Position=537; Antisense; ACCAAAGAGCATGTGACCTTCGCCT
>probe:Drosophila_2:1638870_at:540:315; Interrogation_Position=558; Antisense; GCCTCCGACGATCAGTTGACTAAAA
>probe:Drosophila_2:1638870_at:468:493; Interrogation_Position=612; Antisense; GTAATGCCCATACATCGCGAGAGCC
>probe:Drosophila_2:1638870_at:171:497; Interrogation_Position=639; Antisense; GTGAAAAGTACTCCCTCGTACGGCG
>probe:Drosophila_2:1638870_at:97:129; Interrogation_Position=701; Antisense; ACCACCACTTAGCACGGATTGCAAT
>probe:Drosophila_2:1638870_at:378:555; Interrogation_Position=737; Antisense; GGACGATTACTATAACTTCTCTGAT
>probe:Drosophila_2:1638870_at:164:715; Interrogation_Position=753; Antisense; TTCTCTGATGTGGAGGAACCCTCGA
>probe:Drosophila_2:1638870_at:32:381; Interrogation_Position=768; Antisense; GAACCCTCGATTCTAAGCATGGCTG
>probe:Drosophila_2:1638870_at:537:115; Interrogation_Position=783; Antisense; AGCATGGCTGCTAGGTATCTCAAGA
>probe:Drosophila_2:1638870_at:329:537; Interrogation_Position=850; Antisense; GGTAGCCTGTACTTCAAACTTTCGT
>probe:Drosophila_2:1638870_at:69:457; Interrogation_Position=876; Antisense; GATACTTCTTCATATTTCTCGTCAA
>probe:Drosophila_2:1638870_at:729:291; Interrogation_Position=895; Antisense; CGTCAACTCGTCAACTCAATTTTCA

Paste this into a BLAST search page for me
CAGCCACATCAATTAGTTCCCTAAAGTTTCCAATCTCAAACGTGGCCGAAACCAAAGAGCATGTGACCTTCGCCTGCCTCCGACGATCAGTTGACTAAAAGTAATGCCCATACATCGCGAGAGCCGTGAAAAGTACTCCCTCGTACGGCGACCACCACTTAGCACGGATTGCAATGGACGATTACTATAACTTCTCTGATTTCTCTGATGTGGAGGAACCCTCGAGAACCCTCGATTCTAAGCATGGCTGAGCATGGCTGCTAGGTATCTCAAGAGGTAGCCTGTACTTCAAACTTTCGTGATACTTCTTCATATTTCTCGTCAACGTCAACTCGTCAACTCAATTTTCA

Full Affymetrix probeset data:

Annotations for 1638870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720