FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638871_at:

>probe:Drosophila_2:1638871_at:57:341; Interrogation_Position=2245; Antisense; GCTTTTCTACCACCCTTTATACAAT
>probe:Drosophila_2:1638871_at:318:45; Interrogation_Position=2354; Antisense; ATCGCTATAGTGAACGAACGCATTT
>probe:Drosophila_2:1638871_at:171:381; Interrogation_Position=2369; Antisense; GAACGCATTTGCATTTTAAGCCTAG
>probe:Drosophila_2:1638871_at:583:699; Interrogation_Position=2382; Antisense; TTTTAAGCCTAGACGACAATCCAAG
>probe:Drosophila_2:1638871_at:379:403; Interrogation_Position=2422; Antisense; GACTTGCTAATTTTGTTCGCTTCTT
>probe:Drosophila_2:1638871_at:182:471; Interrogation_Position=2436; Antisense; GTTCGCTTCTTTGGAGTCAAGGTCT
>probe:Drosophila_2:1638871_at:644:533; Interrogation_Position=2456; Antisense; GGTCTGAGTAGATATGGGCTTCTGT
>probe:Drosophila_2:1638871_at:342:441; Interrogation_Position=2471; Antisense; GGGCTTCTGTATCATAGTAGTCGGT
>probe:Drosophila_2:1638871_at:478:13; Interrogation_Position=2525; Antisense; ATTATCACTGAACTCAATCCTACCC
>probe:Drosophila_2:1638871_at:402:673; Interrogation_Position=2545; Antisense; TACCCCAACTTGCAATCGATACGAT
>probe:Drosophila_2:1638871_at:81:3; Interrogation_Position=2632; Antisense; ATATCGAACTCCGTAGCATTTCAGT
>probe:Drosophila_2:1638871_at:386:487; Interrogation_Position=2644; Antisense; GTAGCATTTCAGTATACTCAACAAG
>probe:Drosophila_2:1638871_at:144:395; Interrogation_Position=2673; Antisense; GAAATTGTATTATCCTTGTGAAAGT
>probe:Drosophila_2:1638871_at:449:601; Interrogation_Position=2724; Antisense; TGTTTCACGAATATAAGCAGCCATG

Paste this into a BLAST search page for me
GCTTTTCTACCACCCTTTATACAATATCGCTATAGTGAACGAACGCATTTGAACGCATTTGCATTTTAAGCCTAGTTTTAAGCCTAGACGACAATCCAAGGACTTGCTAATTTTGTTCGCTTCTTGTTCGCTTCTTTGGAGTCAAGGTCTGGTCTGAGTAGATATGGGCTTCTGTGGGCTTCTGTATCATAGTAGTCGGTATTATCACTGAACTCAATCCTACCCTACCCCAACTTGCAATCGATACGATATATCGAACTCCGTAGCATTTCAGTGTAGCATTTCAGTATACTCAACAAGGAAATTGTATTATCCTTGTGAAAGTTGTTTCACGAATATAAGCAGCCATG

Full Affymetrix probeset data:

Annotations for 1638871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720