Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638872_at:

>probe:Drosophila_2:1638872_at:478:459; Interrogation_Position=1644; Antisense; GATTTGGACGCAAACGGTATCCTGA
>probe:Drosophila_2:1638872_at:434:539; Interrogation_Position=1659; Antisense; GGTATCCTGAATGTGACCGCCAAGG
>probe:Drosophila_2:1638872_at:172:597; Interrogation_Position=1670; Antisense; TGTGACCGCCAAGGAGCAGGGCACT
>probe:Drosophila_2:1638872_at:347:501; Interrogation_Position=1732; Antisense; GTCGTCTGTCGCAGGCGGACATCGA
>probe:Drosophila_2:1638872_at:660:401; Interrogation_Position=1749; Antisense; GACATCGACCGCATGCTCAGTGAGG
>probe:Drosophila_2:1638872_at:692:555; Interrogation_Position=1793; Antisense; GGACGAGCGCCATCGCCAGCGGATC
>probe:Drosophila_2:1638872_at:30:301; Interrogation_Position=1820; Antisense; CGCCCGCAATCAACTGGAGACCTAT
>probe:Drosophila_2:1638872_at:492:319; Interrogation_Position=1866; Antisense; GCCGAGAATGGTGGCGATCGCATCA
>probe:Drosophila_2:1638872_at:172:451; Interrogation_Position=1881; Antisense; GATCGCATCAGTGCAGCCGACAAGA
>probe:Drosophila_2:1638872_at:214:197; Interrogation_Position=1996; Antisense; AACTGGAACAGTTCTGCAGCCCCAT
>probe:Drosophila_2:1638872_at:18:581; Interrogation_Position=2051; Antisense; TGGCCAGCAGGCTCCAAACTTTGGA
>probe:Drosophila_2:1638872_at:681:357; Interrogation_Position=2078; Antisense; GCAAGCTGGCGGTTATAAGGGTCCC
>probe:Drosophila_2:1638872_at:597:661; Interrogation_Position=2091; Antisense; TATAAGGGTCCCACCGTCGAGGAGG
>probe:Drosophila_2:1638872_at:669:435; Interrogation_Position=2109; Antisense; GAGGAGGTGGACTAATTCAAACGAA

Paste this into a BLAST search page for me
GATTTGGACGCAAACGGTATCCTGAGGTATCCTGAATGTGACCGCCAAGGTGTGACCGCCAAGGAGCAGGGCACTGTCGTCTGTCGCAGGCGGACATCGAGACATCGACCGCATGCTCAGTGAGGGGACGAGCGCCATCGCCAGCGGATCCGCCCGCAATCAACTGGAGACCTATGCCGAGAATGGTGGCGATCGCATCAGATCGCATCAGTGCAGCCGACAAGAAACTGGAACAGTTCTGCAGCCCCATTGGCCAGCAGGCTCCAAACTTTGGAGCAAGCTGGCGGTTATAAGGGTCCCTATAAGGGTCCCACCGTCGAGGAGGGAGGAGGTGGACTAATTCAAACGAA

Full Affymetrix probeset data:

Annotations for 1638872_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime