FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638873_at:

>probe:Drosophila_2:1638873_at:235:509; Interrogation_Position=2242; Antisense; GTGAAACAAACAACATACCATTAAT
>probe:Drosophila_2:1638873_at:324:515; Interrogation_Position=2304; Antisense; GTGTATTTTTATGCACACACCCATA
>probe:Drosophila_2:1638873_at:299:701; Interrogation_Position=2390; Antisense; TTTTTTGATTTCCAGCGAGCGTTAT
>probe:Drosophila_2:1638873_at:515:629; Interrogation_Position=2400; Antisense; TCCAGCGAGCGTTATATTTTTGATT
>probe:Drosophila_2:1638873_at:565:695; Interrogation_Position=2439; Antisense; TTTACATTTGGCAATAACACTTTGA
>probe:Drosophila_2:1638873_at:444:175; Interrogation_Position=2454; Antisense; AACACTTTGAACTCAGGTGCCTTTA
>probe:Drosophila_2:1638873_at:124:709; Interrogation_Position=2460; Antisense; TTGAACTCAGGTGCCTTTATTTTTT
>probe:Drosophila_2:1638873_at:171:13; Interrogation_Position=2491; Antisense; ATTAAGCCTTGTTATCTTATGCATA
>probe:Drosophila_2:1638873_at:188:181; Interrogation_Position=2545; Antisense; AAAACGAACGCGAATTGATTGCAAA
>probe:Drosophila_2:1638873_at:714:361; Interrogation_Position=2556; Antisense; GAATTGATTGCAAAATGTCTACATG
>probe:Drosophila_2:1638873_at:633:613; Interrogation_Position=2594; Antisense; TGAAGCCGTAACAACATGTAAATTT
>probe:Drosophila_2:1638873_at:540:1; Interrogation_Position=2620; Antisense; ATTAACTTTTTATCGCATATGCAAA
>probe:Drosophila_2:1638873_at:149:657; Interrogation_Position=2741; Antisense; TAACTAATTTGAATCGAGCGACGGG
>probe:Drosophila_2:1638873_at:70:121; Interrogation_Position=2757; Antisense; AGCGACGGGCTCCAAATAAAAATGC

Paste this into a BLAST search page for me
GTGAAACAAACAACATACCATTAATGTGTATTTTTATGCACACACCCATATTTTTTGATTTCCAGCGAGCGTTATTCCAGCGAGCGTTATATTTTTGATTTTTACATTTGGCAATAACACTTTGAAACACTTTGAACTCAGGTGCCTTTATTGAACTCAGGTGCCTTTATTTTTTATTAAGCCTTGTTATCTTATGCATAAAAACGAACGCGAATTGATTGCAAAGAATTGATTGCAAAATGTCTACATGTGAAGCCGTAACAACATGTAAATTTATTAACTTTTTATCGCATATGCAAATAACTAATTTGAATCGAGCGACGGGAGCGACGGGCTCCAAATAAAAATGC

Full Affymetrix probeset data:

Annotations for 1638873_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720